ID: 1069137393

View in Genome Browser
Species Human (GRCh38)
Location 10:64782726-64782748
Sequence GAGGCTTATCACTAATAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137389_1069137393 1 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA 0: 90
1: 51
2: 73
3: 48
4: 226
Right 1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG No data
1069137383_1069137393 26 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT 0: 73
1: 122
2: 58
3: 45
4: 370
Right 1069137393 10:64782726-64782748 GAGGCTTATCACTAATAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137393 Original CRISPR GAGGCTTATCACTAATAGGA AGG Intergenic
No off target data available for this crispr