ID: 1069137394

View in Genome Browser
Species Human (GRCh38)
Location 10:64782727-64782749
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137389_1069137394 2 Left 1069137389 10:64782702-64782724 CCTTCTGGGCAGGGGAGATTAGA No data
Right 1069137394 10:64782727-64782749 AGGCTTATCACTAATAGGAAGGG No data
1069137383_1069137394 27 Left 1069137383 10:64782677-64782699 CCTTTGGAGATTTCTTTGCTTGT No data
Right 1069137394 10:64782727-64782749 AGGCTTATCACTAATAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137394 Original CRISPR AGGCTTATCACTAATAGGAA GGG Intergenic