ID: 1069137394 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:64782727-64782749 |
| Sequence | AGGCTTATCACTAATAGGAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1069137389_1069137394 | 2 | Left | 1069137389 | 10:64782702-64782724 | CCTTCTGGGCAGGGGAGATTAGA | No data | ||
| Right | 1069137394 | 10:64782727-64782749 | AGGCTTATCACTAATAGGAAGGG | No data | ||||
| 1069137383_1069137394 | 27 | Left | 1069137383 | 10:64782677-64782699 | CCTTTGGAGATTTCTTTGCTTGT | No data | ||
| Right | 1069137394 | 10:64782727-64782749 | AGGCTTATCACTAATAGGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1069137394 | Original CRISPR | AGGCTTATCACTAATAGGAA GGG | Intergenic | ||