ID: 1069137886

View in Genome Browser
Species Human (GRCh38)
Location 10:64786356-64786378
Sequence TGTTATGTAACATCACATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069137885_1069137886 2 Left 1069137885 10:64786331-64786353 CCTCTGCAACATTAATGTCATTT No data
Right 1069137886 10:64786356-64786378 TGTTATGTAACATCACATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069137886 Original CRISPR TGTTATGTAACATCACATGT AGG Intergenic
No off target data available for this crispr