ID: 1069140182

View in Genome Browser
Species Human (GRCh38)
Location 10:64812312-64812334
Sequence CCTTATTTCCTGTAGCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069140182_1069140190 22 Left 1069140182 10:64812312-64812334 CCCTTCAGCTACAGGAAATAAGG No data
Right 1069140190 10:64812357-64812379 ATGCTCTTAGGTCATTTATTTGG No data
1069140182_1069140189 10 Left 1069140182 10:64812312-64812334 CCCTTCAGCTACAGGAAATAAGG No data
Right 1069140189 10:64812345-64812367 GGACACACACAGATGCTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069140182 Original CRISPR CCTTATTTCCTGTAGCTGAA GGG (reversed) Intergenic
No off target data available for this crispr