ID: 1069145020

View in Genome Browser
Species Human (GRCh38)
Location 10:64880812-64880834
Sequence AAGAAAAAGCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069145017_1069145020 29 Left 1069145017 10:64880760-64880782 CCATACAGAGGGCATCATGATCA No data
Right 1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069145020 Original CRISPR AAGAAAAAGCAGAATGTGGA AGG Intergenic
No off target data available for this crispr