ID: 1069146389

View in Genome Browser
Species Human (GRCh38)
Location 10:64896740-64896762
Sequence CTGGTCTTAACAGCCTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069146389_1069146394 24 Left 1069146389 10:64896740-64896762 CCCACCAAGGCTGTTAAGACCAG No data
Right 1069146394 10:64896787-64896809 TAGAATCCAGACCTTTCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069146389 Original CRISPR CTGGTCTTAACAGCCTTGGT GGG (reversed) Intergenic
No off target data available for this crispr