ID: 1069146611

View in Genome Browser
Species Human (GRCh38)
Location 10:64900098-64900120
Sequence TTGTTTCTGAATAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069146611_1069146613 -1 Left 1069146611 10:64900098-64900120 CCTGCCTCTTTATTCAGAAACAA No data
Right 1069146613 10:64900120-64900142 ATGCCTGTTTGTTATTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069146611 Original CRISPR TTGTTTCTGAATAAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr