ID: 1069163358

View in Genome Browser
Species Human (GRCh38)
Location 10:65117748-65117770
Sequence TTTTCCTATCTTGTTTAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069163358_1069163362 24 Left 1069163358 10:65117748-65117770 CCCCCTTAAACAAGATAGGAAAA No data
Right 1069163362 10:65117795-65117817 AATGCCCTTCTCTCAACCAGAGG No data
1069163358_1069163364 28 Left 1069163358 10:65117748-65117770 CCCCCTTAAACAAGATAGGAAAA No data
Right 1069163364 10:65117799-65117821 CCCTTCTCTCAACCAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069163358 Original CRISPR TTTTCCTATCTTGTTTAAGG GGG (reversed) Intergenic
No off target data available for this crispr