ID: 1069166206

View in Genome Browser
Species Human (GRCh38)
Location 10:65163647-65163669
Sequence TGTTAGCTTTAGAATCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069166206_1069166209 -8 Left 1069166206 10:65163647-65163669 CCCTCCAGATTCTAAAGCTAACA No data
Right 1069166209 10:65163662-65163684 AGCTAACAAAAGAAAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069166206 Original CRISPR TGTTAGCTTTAGAATCTGGA GGG (reversed) Intergenic
No off target data available for this crispr