ID: 1069169190

View in Genome Browser
Species Human (GRCh38)
Location 10:65203945-65203967
Sequence TCCGTGACTCAGAGCAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069169190_1069169191 7 Left 1069169190 10:65203945-65203967 CCTTGTTTGCTCTGAGTCACGGA No data
Right 1069169191 10:65203975-65203997 CTCTGCTAATTTTGTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069169190 Original CRISPR TCCGTGACTCAGAGCAAACA AGG (reversed) Intergenic
No off target data available for this crispr