ID: 1069169954

View in Genome Browser
Species Human (GRCh38)
Location 10:65214478-65214500
Sequence CCTCCTGTCCTGAAAGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069169950_1069169954 -6 Left 1069169950 10:65214461-65214483 CCAGGAGTACTGTGACCCCTCCT No data
Right 1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG No data
1069169948_1069169954 8 Left 1069169948 10:65214447-65214469 CCCTGGCTAGCACACCAGGAGTA No data
Right 1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG No data
1069169947_1069169954 9 Left 1069169947 10:65214446-65214468 CCCCTGGCTAGCACACCAGGAGT No data
Right 1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG No data
1069169944_1069169954 25 Left 1069169944 10:65214430-65214452 CCATAAGATATGGCAGCCCCTGG No data
Right 1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG No data
1069169949_1069169954 7 Left 1069169949 10:65214448-65214470 CCTGGCTAGCACACCAGGAGTAC No data
Right 1069169954 10:65214478-65214500 CCTCCTGTCCTGAAAGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069169954 Original CRISPR CCTCCTGTCCTGAAAGTGCA AGG Intergenic
No off target data available for this crispr