ID: 1069171420

View in Genome Browser
Species Human (GRCh38)
Location 10:65234535-65234557
Sequence GTTTTTATGGGGATCATGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069171420_1069171424 4 Left 1069171420 10:65234535-65234557 CCTTTCATGATCCCCATAAAAAC No data
Right 1069171424 10:65234562-65234584 GTCCAGAATTCCTCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069171420 Original CRISPR GTTTTTATGGGGATCATGAA AGG (reversed) Intergenic
No off target data available for this crispr