ID: 1069174342

View in Genome Browser
Species Human (GRCh38)
Location 10:65271554-65271576
Sequence CACCCCAAGGGAAAAATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069174342_1069174351 -2 Left 1069174342 10:65271554-65271576 CCCCCCATTTTTCCCTTGGGGTG No data
Right 1069174351 10:65271575-65271597 TGGGCTGTCTGCATGTGCAGAGG 0: 31
1: 56
2: 146
3: 182
4: 469
1069174342_1069174352 13 Left 1069174342 10:65271554-65271576 CCCCCCATTTTTCCCTTGGGGTG No data
Right 1069174352 10:65271590-65271612 TGCAGAGGCCTGTTAGCACTTGG No data
1069174342_1069174353 14 Left 1069174342 10:65271554-65271576 CCCCCCATTTTTCCCTTGGGGTG No data
Right 1069174353 10:65271591-65271613 GCAGAGGCCTGTTAGCACTTGGG No data
1069174342_1069174354 17 Left 1069174342 10:65271554-65271576 CCCCCCATTTTTCCCTTGGGGTG No data
Right 1069174354 10:65271594-65271616 GAGGCCTGTTAGCACTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069174342 Original CRISPR CACCCCAAGGGAAAAATGGG GGG (reversed) Intergenic
No off target data available for this crispr