ID: 1069182304

View in Genome Browser
Species Human (GRCh38)
Location 10:65376788-65376810
Sequence CTGCATCTACTTGTTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069182300_1069182304 20 Left 1069182300 10:65376745-65376767 CCCTAAGACCTGGCAAACTCACT No data
Right 1069182304 10:65376788-65376810 CTGCATCTACTTGTTTTTCAGGG No data
1069182301_1069182304 19 Left 1069182301 10:65376746-65376768 CCTAAGACCTGGCAAACTCACTT No data
Right 1069182304 10:65376788-65376810 CTGCATCTACTTGTTTTTCAGGG No data
1069182302_1069182304 12 Left 1069182302 10:65376753-65376775 CCTGGCAAACTCACTTAATTTCT No data
Right 1069182304 10:65376788-65376810 CTGCATCTACTTGTTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069182304 Original CRISPR CTGCATCTACTTGTTTTTCA GGG Intergenic
No off target data available for this crispr