ID: 1069187554

View in Genome Browser
Species Human (GRCh38)
Location 10:65444427-65444449
Sequence ATTTTAAGGCACAATAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069187554_1069187556 -5 Left 1069187554 10:65444427-65444449 CCACAGTTATTGTGCCTTAAAAT No data
Right 1069187556 10:65444445-65444467 AAAATTTATAACTTGCATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069187554 Original CRISPR ATTTTAAGGCACAATAACTG TGG (reversed) Intergenic