ID: 1069192303

View in Genome Browser
Species Human (GRCh38)
Location 10:65506334-65506356
Sequence GACAGCCCTTGGCCTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069192303_1069192306 11 Left 1069192303 10:65506334-65506356 CCAGTAACAGGCCAAGGGCTGTC No data
Right 1069192306 10:65506368-65506390 GAGTAGTTATCTGAAGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069192303 Original CRISPR GACAGCCCTTGGCCTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr