ID: 1069197904

View in Genome Browser
Species Human (GRCh38)
Location 10:65575210-65575232
Sequence GGGGCATATTTTTAACTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069197903_1069197904 -9 Left 1069197903 10:65575196-65575218 CCAATGGTTTTATAGGGGCATAT No data
Right 1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG No data
1069197898_1069197904 18 Left 1069197898 10:65575169-65575191 CCATTTTGTATTCATCTGTCTTA No data
Right 1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG No data
1069197895_1069197904 21 Left 1069197895 10:65575166-65575188 CCCCCATTTTGTATTCATCTGTC No data
Right 1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG No data
1069197896_1069197904 20 Left 1069197896 10:65575167-65575189 CCCCATTTTGTATTCATCTGTCT No data
Right 1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG No data
1069197897_1069197904 19 Left 1069197897 10:65575168-65575190 CCCATTTTGTATTCATCTGTCTT No data
Right 1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG No data
1069197894_1069197904 22 Left 1069197894 10:65575165-65575187 CCCCCCATTTTGTATTCATCTGT No data
Right 1069197904 10:65575210-65575232 GGGGCATATTTTTAACTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069197904 Original CRISPR GGGGCATATTTTTAACTGCA TGG Intergenic
No off target data available for this crispr