ID: 1069219411

View in Genome Browser
Species Human (GRCh38)
Location 10:65864805-65864827
Sequence ATAGGGAATCAGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069219408_1069219411 2 Left 1069219408 10:65864780-65864802 CCAAAGAATAGACATGGGGAGTA No data
Right 1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG No data
1069219407_1069219411 3 Left 1069219407 10:65864779-65864801 CCCAAAGAATAGACATGGGGAGT No data
Right 1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG No data
1069219403_1069219411 18 Left 1069219403 10:65864764-65864786 CCTAGGGAAAAACATCCCAAAGA No data
Right 1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG No data
1069219402_1069219411 26 Left 1069219402 10:65864756-65864778 CCATGAGGCCTAGGGAAAAACAT No data
Right 1069219411 10:65864805-65864827 ATAGGGAATCAGAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069219411 Original CRISPR ATAGGGAATCAGAATGAAGA AGG Intergenic
No off target data available for this crispr