ID: 1069234540

View in Genome Browser
Species Human (GRCh38)
Location 10:66054222-66054244
Sequence TGGATATACATCCAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 961
Summary {0: 1, 1: 0, 2: 24, 3: 166, 4: 770}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069234540_1069234545 -7 Left 1069234540 10:66054222-66054244 CCTTCCCTTTGGATGTATATCCA 0: 1
1: 0
2: 24
3: 166
4: 770
Right 1069234545 10:66054238-66054260 ATATCCAGCAGTGGGATTGATGG No data
1069234540_1069234547 2 Left 1069234540 10:66054222-66054244 CCTTCCCTTTGGATGTATATCCA 0: 1
1: 0
2: 24
3: 166
4: 770
Right 1069234547 10:66054247-66054269 AGTGGGATTGATGGATCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069234540 Original CRISPR TGGATATACATCCAAAGGGA AGG (reversed) Intronic
902183221 1:14705426-14705448 TGGACATTGATCCAAAGGAAAGG + Intronic
902967491 1:20018669-20018691 AGTATACACATCCAAAGGAAAGG - Intergenic
904151313 1:28443919-28443941 TGGGAATATATCCAAAGGAAAGG - Intronic
904800694 1:33091190-33091212 TGGGTATACATCCAAAGGAAAGG - Intronic
905347463 1:37320648-37320670 TGGGTATAGATCCAAAAGAAAGG + Intergenic
905542011 1:38767297-38767319 TGGAGCAACATCGAAAGGGAGGG + Intergenic
905840533 1:41173609-41173631 TGGGTATATATCCATAGGAAAGG + Intronic
906392842 1:45433779-45433801 TGGGTATTTATCCAAAGGAAGGG - Intronic
906549438 1:46650518-46650540 TGGATATATATCCAAAGGAAAGG + Intronic
906762649 1:48390077-48390099 TGGGTATCCATCCAAAGGAAAGG + Intronic
906765885 1:48432774-48432796 TGGATATATATTCAAAAGCATGG + Intronic
906812194 1:48839173-48839195 TGGATATCCATCGAAAAGAAAGG + Intronic
906969423 1:50495604-50495626 TGGGTATATACCCAAAAGGAGGG - Intronic
907007075 1:50925741-50925763 TGGGTATTTATCCAAAGGAAAGG + Intronic
907025025 1:51108916-51108938 TGCATATACATTTAAAGGAAAGG - Intronic
907231028 1:52998632-52998654 TGGATATACCTGCAAAAGTATGG - Intronic
907844623 1:58192802-58192824 TGGGTATATACCCAAAGGGAAGG - Intronic
908012625 1:59796091-59796113 TGGTTATGTATCCAAAGGAAAGG + Intergenic
908567542 1:65373301-65373323 TGGGTATATATCCAAAAGAAAGG - Intronic
908579141 1:65495545-65495567 TGGATATTTATCCAAAGGAAAGG + Intronic
910193295 1:84616067-84616089 TGGATATATATCCAAAGGAATGG + Intergenic
910431638 1:87165424-87165446 TTGATATAAATCCAAGTGGAGGG + Intronic
910931866 1:92450826-92450848 TGGATATTTATCCAAAGGAAAGG - Intergenic
910979709 1:92947592-92947614 TGGGTATTTATCCAAAGGAAAGG + Intronic
911082514 1:93947373-93947395 TGGGTATTTATCCAAAGGAAAGG - Intergenic
911509932 1:98799034-98799056 TGGATATGTATCCAAAAGAAAGG - Intergenic
911614962 1:100000074-100000096 TGGGTATTTATCCAAAGGAAAGG - Intronic
911818914 1:102391207-102391229 TTGATTTACATCCACTGGGATGG + Intergenic
911837567 1:102640891-102640913 TGGGTATATATCCAAAAGAAAGG - Intergenic
911938626 1:104013119-104013141 TGGGTATATATCCAAAAGAAAGG - Intergenic
912148293 1:106821929-106821951 TGGAAATTTATCCAAAGGAAAGG - Intergenic
913044951 1:115066242-115066264 TGGGTATATATCCAAAAGAAAGG - Intronic
914443609 1:147729375-147729397 TGGTTATTTATCCAAAGGAAAGG - Intergenic
915925310 1:160013566-160013588 TGGGTATTTATCCAAAGGAAAGG + Intergenic
916301713 1:163282780-163282802 TGGGTACATATCCAAAGGAAAGG + Intronic
916638838 1:166704380-166704402 TGGGTATATATCCAAAGGAAAGG + Intergenic
917351228 1:174080313-174080335 TGGGTATACATCCAAAAGAAAGG + Intergenic
917383638 1:174443215-174443237 TGGGTATATATCCAAAAGAAAGG - Intronic
917558081 1:176113045-176113067 TGGCTATATATCCAAAAGAAAGG - Intronic
917558981 1:176124764-176124786 TGGGTATATATCCAAAAGAAAGG - Intronic
917580391 1:176371423-176371445 TGGATGTATATCCAAAGAAAAGG - Intergenic
917841547 1:178984011-178984033 TGGGTATTTATCCAAAGGAAAGG + Intergenic
918166672 1:181955780-181955802 TGGACATTTATCCAAAGGAAAGG - Intergenic
918199335 1:182252549-182252571 TGGGTATATATCCAAAAGAATGG + Intergenic
918364577 1:183793895-183793917 TGGGTATTTATCCAAAGGAAAGG + Intronic
918769643 1:188539092-188539114 TGGGTATATATCCAAAAGAAAGG - Intergenic
918984420 1:191604978-191605000 AGGATTTAAATCCAAAAGGATGG - Intergenic
919044452 1:192433224-192433246 TGGGTATTTATCCAAAGGAAAGG + Intergenic
919233305 1:194804573-194804595 TGGATATAGATCCAAAAGAAAGG - Intergenic
919563787 1:199158283-199158305 TGGGTATATATCCAAAGGAAAGG + Intergenic
919962144 1:202482231-202482253 TGTGTACACATCCAAAGGAAAGG - Intronic
920273540 1:204786126-204786148 TGGGTATATATTCAAAGGAAAGG - Intergenic
920828086 1:209440739-209440761 TGGATTTAAAACCAAAGGGCAGG + Intergenic
920923411 1:210318413-210318435 TGGGTATATATCCAAAAGAAAGG - Intergenic
920998964 1:211023307-211023329 TGGGTATATATCCAAAGGAAAGG + Intronic
921295665 1:213699552-213699574 TGGGTATATACCCAAAAGGAAGG - Intergenic
921411683 1:214842753-214842775 TGGATATATATCCAAAGGAGAGG - Intergenic
921457239 1:215386700-215386722 TGGGTATATATCCAAAAGAAAGG + Intergenic
921631148 1:217435495-217435517 TGGATAAACAGCCAATGGAAGGG + Intronic
922672821 1:227525980-227526002 TGGGTATATACCCAAAAGGAAGG - Intergenic
922773082 1:228199811-228199833 TGGGTATTTATCCAAAGGAAAGG + Intergenic
922817698 1:228462421-228462443 TGGGTATATATCCAAAAGAAAGG + Intergenic
923834984 1:237601079-237601101 TGGGTATATATCCCAAGGAAAGG + Intronic
923868277 1:237963475-237963497 AGGATGTAAATCCAGAGGGAGGG + Intergenic
923938580 1:238793524-238793546 TGAGTATTCATCCAAAGGAAAGG + Intergenic
924422566 1:243923428-243923450 TGGGTATACACCCAAAAGAATGG - Intergenic
924649429 1:245911361-245911383 TGGATATAGATCCAAAAGAAAGG + Intronic
924861486 1:247928018-247928040 TGGGCATATATCCAAAGGAAAGG - Intergenic
1063413655 10:5855956-5855978 AGGACATACATCCCCAGGGAGGG + Intergenic
1063749388 10:8925230-8925252 AGGATAAACATGAAAAGGGATGG + Intergenic
1064361912 10:14673631-14673653 TGGGTATGCATCCAAAGGGAAGG - Intronic
1064476191 10:15691338-15691360 TGGGCATATATCCAAAGGAAAGG + Intronic
1064735285 10:18375989-18376011 TGGATATATACCCAAAAGAAAGG + Intronic
1065554021 10:26895940-26895962 TGGGTATACATCTAAAAGAAAGG + Intergenic
1065599256 10:27352368-27352390 TGGGTATACATCCAAAAGAAAGG - Intergenic
1065714843 10:28556076-28556098 TGGATATCTATCCAAAGGAAAGG - Intronic
1065876948 10:30005534-30005556 TGGATATATACCCAAAAGAAAGG - Intergenic
1065878506 10:30018908-30018930 TGGGTATGTATCCAAAGGAAAGG + Intronic
1065907116 10:30265940-30265962 TAGGTATACACCCAAAGGAAAGG + Intergenic
1066087754 10:31987689-31987711 TGAATAAACATCCTAAGGAATGG + Intergenic
1066724695 10:38378515-38378537 TGGAGATAATTCCAAAAGGAAGG - Intergenic
1066762691 10:38771014-38771036 TGGATATATATCCAAAATAAAGG - Intergenic
1066958890 10:42201442-42201464 TGGATATATATCCAAAATAAAGG + Intergenic
1068187863 10:53610536-53610558 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1068593655 10:58877319-58877341 TGGATATTTGTCCAAAGGAAAGG - Intergenic
1069234540 10:66054222-66054244 TGGATATACATCCAAAGGGAAGG - Intronic
1069269517 10:66507845-66507867 TGGGTATTTATCCAAAGGAAAGG - Intronic
1069397322 10:68003854-68003876 TGGGTATACACCCAAAAGAAAGG - Intronic
1069414878 10:68189862-68189884 TGGATATATATCCAAAAGAAAGG - Intronic
1070049415 10:72872759-72872781 TGGGCATATATCCAAAGGAAAGG - Intronic
1071214497 10:83384211-83384233 TGGGTATATATCCAAAAGAAAGG - Intergenic
1071248722 10:83792870-83792892 TGGCTATATATCCAAAAGAAAGG - Intergenic
1071938838 10:90563865-90563887 TGGATATATATCCAAAGGAAAGG - Intergenic
1072771809 10:98146902-98146924 TGGATATATATCCAAAAGAAAGG - Intronic
1073197082 10:101700588-101700610 TGTGTATATATGCAAAGGGAAGG + Intergenic
1073437021 10:103523935-103523957 TAGGTATATATCCAAAGGAAAGG - Intronic
1074173481 10:110970528-110970550 TGGGTATATATCCAAAGGAAAGG - Intronic
1074793354 10:116914730-116914752 TGGATATACAAACAAAGGCAGGG + Intronic
1074812373 10:117118545-117118567 TGGTTATATATCCAAAAGAAAGG + Intronic
1075990272 10:126831925-126831947 TGGAAATTTATCCAAAGGAAAGG + Intergenic
1076920400 10:133450114-133450136 TGGGTATTTATCCAAAGGAAGGG + Intergenic
1077195913 11:1279917-1279939 TGGAAAGACATCCAAAGAGCAGG + Intronic
1077682723 11:4259379-4259401 TGGGTATACACCCAAAAGAAAGG - Intergenic
1077692480 11:4358551-4358573 TGGGTATACACCCAAAAGAAAGG + Intergenic
1077728922 11:4707073-4707095 TGAGTATATATCCAAAGGAAAGG - Intronic
1077767588 11:5177857-5177879 TGGTTTTACCTCCAAAGCGATGG + Exonic
1077970691 11:7186781-7186803 TGGGTATATATTCAAAGGAAAGG - Intergenic
1078512215 11:11993937-11993959 TGGGGATACAGACAAAGGGAAGG - Intronic
1078693476 11:13605397-13605419 TGGGTATATACCCAAAGGAAAGG - Intergenic
1078750683 11:14159530-14159552 TGGGTATAGATCCAAAAGAAAGG + Intronic
1078786308 11:14497687-14497709 TGGGTATATATCCAAAAGAAAGG + Intronic
1078834300 11:15012324-15012346 GTGTTATAAATCCAAAGGGAGGG - Intronic
1079113507 11:17622847-17622869 TGGGTATACACCCAAAAGAAAGG - Intronic
1079278742 11:19068610-19068632 TGGATATATATCTGAAGGGAAGG - Intergenic
1080316098 11:30950342-30950364 TGGATATACATCCAAAAGAAAGG + Intronic
1080989491 11:37513515-37513537 TGGATATATACCCAAAAGAAAGG + Intergenic
1081044984 11:38262297-38262319 TGGGTATATATCCAAAAGAAAGG - Intergenic
1082697208 11:56383459-56383481 TGGATATATAGCCAAAAGAAAGG - Intergenic
1082911538 11:58381397-58381419 TGGGTATATACCCAAAGGAAAGG + Intergenic
1082963492 11:58941552-58941574 TGGGTATATACCCAAAGGGGAGG + Intronic
1083125147 11:60557768-60557790 TGGGTATATATCCAAAAGAAAGG + Intergenic
1083790444 11:64981626-64981648 TGGGTATAGATCCAAAAGAAAGG - Intergenic
1084986811 11:72881534-72881556 TGGATATTTATCCAAAGGAAAGG + Intronic
1084995657 11:72975296-72975318 TGGATATATATCCAAATGAATGG - Intronic
1085664718 11:78404102-78404124 TGGCTATATATCCAAAAGAAAGG + Intronic
1085817325 11:79753227-79753249 TGGCTATTTATCCAAAGGAAAGG + Intergenic
1086376753 11:86208534-86208556 TGGATATATATCCAAAAGAAAGG + Intergenic
1086548256 11:88024530-88024552 TGGGTATATACCCAAAAGGAAGG + Intergenic
1086560733 11:88166055-88166077 TGGATGTGCTTCCAAAGGGAAGG + Intronic
1086719953 11:90107609-90107631 TGGATATATATCCAAAATAAAGG - Intergenic
1086850798 11:91805320-91805342 TGGTTATATATCCAAAAGAAAGG - Intergenic
1086999668 11:93402503-93402525 TGGGTATATATCCAAAAGAAAGG + Intronic
1087339390 11:96883295-96883317 TGGGTATATATGCAAAGGAAAGG + Intergenic
1087664821 11:101031969-101031991 TGGACAGACATGCAAAGGTAGGG + Exonic
1087732975 11:101799292-101799314 TGGATACATATCCAAAAGAATGG + Intronic
1088145015 11:106666135-106666157 TGGATATTTATGCAAAGGAAAGG - Intergenic
1088406436 11:109484857-109484879 TGGATATATACCCAAAAGAAAGG + Intergenic
1088703383 11:112435150-112435172 TGGGTATATACCCAAAGGGAAGG + Intergenic
1088779629 11:113121765-113121787 TGGATAGGCACCCAAAGGAATGG - Intronic
1089418824 11:118315829-118315851 AGAAGTTACATCCAAAGGGAAGG - Exonic
1089532619 11:119140786-119140808 TGGGTATATATCCAAAAGAAAGG - Intergenic
1089815517 11:121170348-121170370 TGGGTATTTATCCAAAGGAAAGG - Intronic
1091537231 12:1422692-1422714 TAGGTATATATCCAAAGGAAAGG - Intronic
1092668467 12:10834106-10834128 TGGGTATGTATCCAAAGGAAAGG - Intronic
1092701630 12:11237742-11237764 TAGATATCTATCCAAAGGAAAGG - Intergenic
1092941745 12:13415613-13415635 TGGGTATATATCCAAAAGAAAGG + Intergenic
1092992304 12:13914567-13914589 TGGGTATACATCCCAAAGAAAGG + Intronic
1093138748 12:15482003-15482025 TGGGTATCTATCCAAAGGAAAGG + Intronic
1093536017 12:20224447-20224469 TGGGTATACATCCAAAAGAAAGG + Intergenic
1093790854 12:23248658-23248680 TGCATATGCATCCAAAGACAAGG - Intergenic
1093887649 12:24480902-24480924 TGGGTATGTATCCAAAGGAAAGG + Intergenic
1093916631 12:24809642-24809664 TAGGTATACATCCAAAAGAAAGG - Intergenic
1094096273 12:26708243-26708265 TAGGTATACACCCAAAAGGAAGG + Intronic
1094136745 12:27135745-27135767 TGGATATATACCCAAAGGAAAGG + Intergenic
1094186476 12:27648495-27648517 TGGATATATACCCAAAGGAAAGG + Intronic
1094312829 12:29104288-29104310 TGGAGAACCATCCAAAGGTAGGG - Intergenic
1094345077 12:29459129-29459151 TAGGTATACATCCAAAAGAAAGG + Intronic
1094763670 12:33565148-33565170 TGGGTATATATCCAAAGGAAAGG + Intergenic
1095134255 12:38579331-38579353 TGGGTATATATCCAAAAGAAAGG + Intergenic
1095228707 12:39707504-39707526 TGGATATATACCCAAAAGAAAGG + Intronic
1095558570 12:43538012-43538034 TGGGTATACACCCAAATGAAAGG - Intronic
1095853502 12:46835829-46835851 TGGGTATATATCCAAAAGGAAGG - Intergenic
1095900390 12:47321740-47321762 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1096017422 12:48290204-48290226 TGGGTATTTATCCAAAGGAAGGG + Intergenic
1096415909 12:51412911-51412933 TGGGTATTTATCCAAAGGAAAGG - Intronic
1097431208 12:59509766-59509788 TGGATATACACCCAAAAGACAGG + Intergenic
1097431271 12:59510717-59510739 TGGATATACACCCAAAAGACAGG + Intergenic
1097525720 12:60732998-60733020 TGGGTATATATCCAAAGGAAAGG - Intergenic
1097562869 12:61230288-61230310 TGGGTATACACCCAAAAGGAAGG - Intergenic
1097819365 12:64112728-64112750 TAGGTATACATCCAAAAGAAAGG - Intronic
1097976032 12:65687289-65687311 TGGATATATATCCAAAGGAAAGG + Intergenic
1098101475 12:67022181-67022203 TGGATATATATCCAAAGGAGAGG - Intergenic
1098101480 12:67022190-67022212 TGGATATATATCCAATGGTGGGG + Intergenic
1098215417 12:68211401-68211423 TGGATATATATCCTAAAGAAAGG - Intronic
1098267924 12:68741501-68741523 TGTATAAACATCCAAAGGAGTGG + Intronic
1098514859 12:71363006-71363028 TGGGTATATATCCAAAGGAAAGG + Intronic
1098529077 12:71520046-71520068 TAGATATATACCCAAAGGAATGG + Intronic
1099039025 12:77627674-77627696 TGGATATTTATCCAAAGGAAAGG + Intergenic
1099092943 12:78336920-78336942 TGGAGATAGATCCAAAAGAAAGG + Intergenic
1099114502 12:78608000-78608022 TGCATATATATCCAAAAGAAAGG + Intergenic
1099370969 12:81829359-81829381 TGAATATTCATCCAAAAGAAAGG - Intergenic
1100925162 12:99537256-99537278 TGGATATATACCCAAAGAAAAGG - Intronic
1101106098 12:101441930-101441952 TGGGTATATATCCAAAAGAAAGG - Intergenic
1101499749 12:105291864-105291886 TGGGTATATATCCAAAAGAAAGG + Intronic
1101545741 12:105711028-105711050 TGGAGAAACACCCAAACGGATGG + Intergenic
1101608107 12:106265407-106265429 TGGGTATACACCCAAAAGAAAGG + Intronic
1101792953 12:107946900-107946922 TGGATATATATCCAAAAGAAAGG + Intergenic
1101798002 12:107994180-107994202 TGGGTATATATCCAAAGTAAAGG - Intergenic
1103056309 12:117823896-117823918 TGGGTATACACCCAAAAGAAAGG + Intronic
1103131747 12:118475129-118475151 TAGATCTACATCCAAAAGGAAGG + Intergenic
1103187471 12:118972064-118972086 TGAATATACATCCAAATGAGAGG + Intergenic
1105494300 13:20916965-20916987 TGGATATATATCCAAAAGAACGG + Intergenic
1105537765 13:21285515-21285537 TGGGTATTTATCCAAAGGAATGG + Intergenic
1105666623 13:22565597-22565619 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1106052569 13:26205469-26205491 TGGATATATATCCCATGGAAAGG - Intronic
1106351278 13:28932937-28932959 GGGATATACATCCAAAATAAAGG + Intronic
1106386939 13:29296132-29296154 TGGGTATATATCCAAAGGAAAGG - Intronic
1106388739 13:29314820-29314842 TGGGTATATATCCAAAGGAAAGG + Intronic
1106723626 13:32462088-32462110 GGGATATTTATCCAAAGGAAAGG + Intronic
1106817833 13:33429170-33429192 TGGATATAAACCCAAAAGAAAGG + Intergenic
1106818009 13:33430570-33430592 TGGATATATATCCAAAAGAATGG + Intergenic
1106842744 13:33702585-33702607 TGGGTATATATCCAAAAGAAAGG - Intergenic
1107318741 13:39162912-39162934 TGGGTATATATCCAAAGGAAAGG - Intergenic
1107319701 13:39172786-39172808 TGGGTATATATCCAAAGGAAAGG - Intergenic
1107379238 13:39837893-39837915 TGGATATATATCCAAAAGAAAGG - Intergenic
1107386960 13:39921107-39921129 TTGAAATATAGCCAAAGGGAAGG - Intergenic
1107953672 13:45487880-45487902 TGGGTATTTATCCAAAGGCAAGG + Intronic
1108136713 13:47371431-47371453 TGGTTATATAGCCAAAGGAAAGG + Intergenic
1108432687 13:50370141-50370163 TGGAAATATACCCAAAGGAATGG + Intronic
1108645105 13:52419640-52419662 TGGGTATATATCCAAAAGAAAGG + Intronic
1108741543 13:53343723-53343745 TGGATATACTTCAATAGGGAGGG - Intergenic
1108952409 13:56111866-56111888 TAGGTATACATCCAAAAGAAAGG - Intergenic
1108993126 13:56689489-56689511 TGGATATATACCCAAAAGAAAGG + Intergenic
1109015570 13:57008391-57008413 TGGGTATATATCCAAAGGAAAGG + Intergenic
1109129121 13:58558358-58558380 TGGAAATATATCCAAAAGAAAGG - Intergenic
1109290192 13:60464399-60464421 TGGATATATATTCAAAAGAAAGG + Intronic
1109292007 13:60487764-60487786 TGGGTATTTATCCAAAGGAAAGG - Intronic
1109815964 13:67585185-67585207 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1109993882 13:70096187-70096209 TGGGTATATATCCAAAAGGAAGG - Intronic
1110122407 13:71899038-71899060 TGGATGTTTATCCAAAGGAAAGG + Intergenic
1110148272 13:72220907-72220929 TGGATATACATCCTATGAGTAGG - Intergenic
1110192851 13:72751246-72751268 TAGGTATATATCCAAAGGAAAGG + Intronic
1110547439 13:76771261-76771283 TGGATATCTATCCAAAGAAAAGG + Intergenic
1111181881 13:84679874-84679896 TGGGTATATACCCAAAGGGAAGG - Intergenic
1111204061 13:84980606-84980628 TGGGTATATATCCAAAAGAACGG - Intergenic
1111376717 13:87389164-87389186 TGTGTATATATCCAAAGGAAAGG - Intergenic
1111452426 13:88436747-88436769 TGGGTGTATATCCAAAGGAAAGG + Intergenic
1111506131 13:89191238-89191260 TGGGTATATATTCAAAGGAAAGG + Intergenic
1111876407 13:93902549-93902571 TGGCTATAGATCTAAAGGAAGGG - Intronic
1112036698 13:95503385-95503407 TTTATATAAAACCAAAGGGAAGG + Intronic
1112081479 13:95976414-95976436 TGGATATATACCCAAAAGTAAGG - Intronic
1112419719 13:99237012-99237034 TGGATATATATTCAAAAGAAAGG + Intronic
1112648521 13:101364217-101364239 TGGGTATATATCCAAAAGGGAGG + Intronic
1112859909 13:103817872-103817894 TGGAACTACATCCAAGTGGAAGG + Intergenic
1114326836 14:21597853-21597875 TGGATATATACCCAAAAGAAAGG + Intergenic
1114374995 14:22135379-22135401 TGGATATATACCCAGAGGTAGGG - Intergenic
1114651816 14:24289990-24290012 TAGATAACCATCCAAAGTGATGG - Intergenic
1114878007 14:26747316-26747338 TAGGTATATATCCAAAAGGAAGG + Intergenic
1114982595 14:28184469-28184491 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1114984715 14:28211589-28211611 TGGATATATATCCAAAAGAAAGG - Intergenic
1115171281 14:30510285-30510307 TGGGTATACACCCAAAAGAAAGG + Intergenic
1115195022 14:30788282-30788304 TGGGTATTTACCCAAAGGGAAGG + Intergenic
1115276289 14:31612939-31612961 TGGGTATATACCCAAAAGGAAGG + Intronic
1115295544 14:31821681-31821703 TGGGTATACACCCAAAAGAAAGG + Intronic
1115675391 14:35667802-35667824 TGGATATACATACAAAGGAAAGG + Intronic
1115678451 14:35708741-35708763 TGGGTATACACCCAAAAGAAAGG + Intronic
1115748381 14:36461831-36461853 TGGAGACCCATCCTAAGGGAAGG + Intergenic
1115853206 14:37603513-37603535 TGGATATTCAGCAAAAAGGAAGG - Intronic
1116062718 14:39944137-39944159 TAGGTATACATCCAAAAGAAAGG - Intergenic
1116098559 14:40405056-40405078 TGGTTATATATCCAAAAGAAAGG - Intergenic
1116346454 14:43801428-43801450 TGGGTATATATCCAAAAGAAAGG + Intergenic
1116393934 14:44425625-44425647 TAGGTATATACCCAAAGGGAAGG + Intergenic
1116431542 14:44851305-44851327 TGGACATTTATCCAAAGGAAAGG - Intergenic
1116602098 14:46938758-46938780 CTGATATTTATCCAAAGGGAAGG + Intronic
1116703689 14:48268293-48268315 TGGATATATATCCAAAAGAAAGG - Intergenic
1116889441 14:50253678-50253700 TGGATATATACCCAAAAGAAAGG + Intronic
1117503970 14:56382341-56382363 TAGATATACATCCAAAAGAAGGG - Intergenic
1118115060 14:62766323-62766345 TGGGTATATACCCAAAAGGAAGG + Intronic
1118497342 14:66321234-66321256 TGAGTATATATCCAAAGGAAAGG + Intergenic
1118546886 14:66900883-66900905 TGGATATATATCCAAAAGAAGGG - Intronic
1118556452 14:67028361-67028383 TTGGTATATATCCAAAGGAAAGG - Intronic
1118919307 14:70135386-70135408 TGGGTATATATCCAAAAGAAAGG + Intronic
1119027039 14:71161892-71161914 TGGGTATATATCCAAAAGTAAGG + Intergenic
1119049086 14:71348578-71348600 TAGACATACATCTAATGGGAAGG - Intronic
1119152926 14:72380816-72380838 TGGACATTTATGCAAAGGGAAGG + Intronic
1119370729 14:74139547-74139569 TGGAGAAATAGCCAAAGGGAGGG - Intronic
1119962144 14:78871057-78871079 TGGGTATATATCCAAAAGAAAGG - Intronic
1120181681 14:81349723-81349745 TGGGTATTTATCCAAAGGAAAGG + Intronic
1120394222 14:83947326-83947348 TGGGTATTCATCCAAAGGAAAGG - Intergenic
1120580071 14:86236152-86236174 TAGATATATACCCAAAGGAAAGG + Intergenic
1121593843 14:95143399-95143421 TTTATATACATTGAAAGGGAGGG - Intronic
1122656315 14:103262217-103262239 TGGATATTTATCCAAAAGAAAGG - Intergenic
1122761178 14:104028186-104028208 TGGATATTTATCCAAAGGAAAGG - Intronic
1123100527 14:105795579-105795601 TGCATATATATCCAAAAGAAAGG + Intergenic
1202934013 14_KI270725v1_random:67270-67292 TGGATATATATCCAAAATAAAGG - Intergenic
1124504049 15:30256783-30256805 TGGGTATGCATCCAAAGGAAAGG - Intergenic
1124739504 15:32281863-32281885 TGGGTATGCATCCAAAGGAAAGG + Intergenic
1125052418 15:35315685-35315707 TGGGTATATATCCAAAAGAAAGG + Intronic
1125232386 15:37470750-37470772 TGGGTATACATCCAAAGGAAAGG + Intergenic
1125851460 15:42907325-42907347 TGGGTATATATCCAAAAGAAAGG + Intronic
1126202610 15:46004551-46004573 TGGGTATATATCCAAAAGAAAGG - Intergenic
1126567782 15:50117650-50117672 TGGGAATACATCCAAAAGAAAGG + Intronic
1126610558 15:50524927-50524949 TGGATATACGTCCAAAGGAATGG + Intronic
1126630900 15:50734140-50734162 TGGATATACATGCAAAAGAAAGG + Intronic
1126726488 15:51637200-51637222 TGGATCCACATCCAAAGAGTGGG + Intergenic
1127403739 15:58618995-58619017 TGGGTATACATCCAAAGAAAAGG + Intronic
1127763225 15:62161640-62161662 TGGGTATATATTCAAAGGAAAGG + Intergenic
1128229627 15:66025421-66025443 TGGAGAAAGCTCCAAAGGGAGGG + Intronic
1128252932 15:66176304-66176326 TGGGTATTTATCCAAAGGAAAGG + Intronic
1128400068 15:67269979-67270001 TGGGTATATATCCAAAAGAAAGG - Intronic
1128436218 15:67651854-67651876 TGGGTATATATCCAAAAGAAAGG - Intronic
1129597766 15:76978152-76978174 AGGGTATACATCCAAAGGAAAGG - Intergenic
1130047941 15:80460750-80460772 TGGATGTAGATCAAAAAGGAAGG + Intronic
1130634961 15:85609594-85609616 TGGGTATATATCCAAAGGACAGG - Intronic
1131004078 15:88962000-88962022 TGGACATTTATCCAAAGGAAAGG - Intergenic
1131004230 15:88963399-88963421 TGGACATTTATCCAAAGGAAAGG - Intergenic
1133082374 16:3332872-3332894 TGGATATATATTCAAAAGAAAGG - Intergenic
1133343246 16:5052774-5052796 TGGATATTTATCCAAAGGAAAGG + Intronic
1133384641 16:5359309-5359331 TGGGTATACACGCAAAAGGAAGG - Intergenic
1134417135 16:14053950-14053972 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1136646319 16:31620926-31620948 TGGGTATATATCCAAAAGAAAGG + Intergenic
1136658822 16:31735407-31735429 TGGGTATATATCCAAAAGAAAGG - Intronic
1137880505 16:52041568-52041590 TGGGTATATACCCAAAGGAACGG - Intronic
1138100393 16:54247469-54247491 TGGATATATAACCAAAAGAATGG - Intronic
1138498121 16:57420903-57420925 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1138757459 16:59505677-59505699 TGAGTATACATCCAAAAGAATGG + Intergenic
1138890672 16:61140544-61140566 TGGGTATATATCCAAAAGAAAGG - Intergenic
1139044763 16:63043277-63043299 TGGATTTATATCCAAAAGAAAGG - Intergenic
1139344112 16:66290957-66290979 TGGGTAGACATCCAAAAGAAAGG + Intergenic
1140175675 16:72657187-72657209 TGGGTATACATCCAAAAGAAAGG + Intergenic
1140421039 16:74819091-74819113 TGGACATTTATCCAAAGGAAAGG - Intergenic
1141038442 16:80650615-80650637 TGGGTATACACCCAAAAGAAAGG + Intronic
1141236392 16:82221795-82221817 TGGGTATATATCCAAAAGAAAGG - Intergenic
1141306617 16:82870462-82870484 TGGATATATATCTAAAAGAAAGG + Intronic
1142927850 17:3256825-3256847 TGGACATAAAACAAAAGGGAAGG - Intergenic
1143256889 17:5564686-5564708 AGGGTATACATCCAAAAGAAAGG - Intronic
1144598685 17:16593807-16593829 TGGGTATATATCCAAAAGAAAGG + Intergenic
1145116945 17:20219145-20219167 TGGGTATACACCCAAAAGAAAGG - Intronic
1145337810 17:21927814-21927836 TGGAAATACATCGAATGGAATGG + Intergenic
1146259939 17:31414689-31414711 TGGCTAGACATCCAGAGGGCTGG - Intronic
1146995473 17:37316692-37316714 TGGGTATATATCCAAAAGAAAGG + Intronic
1149110870 17:53028309-53028331 TGGGTATACACCCAAAAGAAAGG - Intergenic
1149882860 17:60310238-60310260 TGGGTATATATCCAAAAGAAAGG + Intronic
1150151951 17:62817185-62817207 TGGGTATATATCCAAAAGAAAGG + Intergenic
1150518556 17:65841145-65841167 TGAATATATATCCAAAAGAAAGG + Intronic
1150542556 17:66118157-66118179 TGGGTCTACATCCAAAAGAAAGG + Intronic
1150895627 17:69207384-69207406 CTGGTATACATCCTAAGGGAAGG + Intronic
1151780584 17:76242346-76242368 TGGATAAACCCACAAAGGGAAGG - Intergenic
1152840639 17:82565803-82565825 TGGATATAGACCCAAACTGAAGG + Intronic
1153137971 18:1939980-1940002 TGGATATACACCCAAAGGAAAGG - Intergenic
1153440443 18:5112211-5112233 TTGATATATATCCAAAAGAAAGG - Intergenic
1153511594 18:5860457-5860479 TGGATATATACCCAAAAGAAAGG + Intergenic
1153585115 18:6612831-6612853 TGCATGTCCATCCTAAGGGAAGG - Intergenic
1153585898 18:6619917-6619939 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1153864711 18:9253860-9253882 TGGGTATACACCCAAAAGAAAGG + Intronic
1154295788 18:13146140-13146162 TGGGTATATATCCAAAAGAACGG + Intergenic
1154381579 18:13855934-13855956 TGGGTATAGATCCAAAAGAAGGG + Intergenic
1154387047 18:13903339-13903361 TGGATATATACCCAAAGGGAAGG + Intronic
1155088428 18:22481771-22481793 TGGATATTTATCCAAAGGAAAGG + Intergenic
1155136843 18:23004123-23004145 TGGGTGTATATCCAAAGGAAAGG + Intronic
1155902835 18:31412020-31412042 TGGGTATATATCCAAAAGAAAGG + Intronic
1155912280 18:31517824-31517846 TGCACACACATCCATAGGGATGG + Intronic
1156277629 18:35598725-35598747 TGGGTATATATCCAAAAGAAAGG - Intronic
1156344900 18:36247946-36247968 TGGGTATTTATCCAAAGGAAAGG - Intronic
1156433785 18:37104164-37104186 TGGATATTTATCCAAAGGAAAGG + Intronic
1157072564 18:44425118-44425140 TGGATATATACCCAAAAGAAGGG + Intergenic
1157152845 18:45236758-45236780 TGCATATATAGCCAAAGGAAAGG - Intronic
1157156502 18:45272239-45272261 TGGGTATATATCCAAAAGAAAGG + Intronic
1157226595 18:45871425-45871447 TGGGTATATATCCAAAAGAAAGG + Intronic
1157779554 18:50425538-50425560 TGGATTAACATCCAAAGGCTGGG - Intergenic
1157821478 18:50774400-50774422 TGGGTATTTATCCAAAGGGAAGG + Intergenic
1157917755 18:51684807-51684829 TGGGTATATATCCAAAAGAAAGG + Intergenic
1158767825 18:60476481-60476503 TGGATATATATCCAAAGAAAAGG - Intergenic
1159572278 18:70130274-70130296 TGGGTATATATCCAAAAGAAAGG + Intronic
1159710853 18:71757763-71757785 TGGATATATACCCAAAAGAAAGG + Intronic
1159730690 18:72023481-72023503 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1159976567 18:74719992-74720014 TGGACATTCATCCAAAGGAAAGG - Intronic
1161556664 19:4946512-4946534 TGGATATACACCCAAAAGAATGG - Intronic
1161899216 19:7105302-7105324 TGGATATACAGACAAATGGGTGG + Intergenic
1162277680 19:9670323-9670345 TGGGTATATATCCAAAAGAAAGG + Intronic
1163379309 19:16954517-16954539 TGGGTATACACCCAAAAGAATGG + Intronic
1164810912 19:31155054-31155076 TGGAGATAATTCCAAAGAGAAGG + Intergenic
1165135385 19:33665093-33665115 TGGGTATATATCCAAAAGAAAGG - Intronic
1165556313 19:36635691-36635713 TGGGTACATATCCAAAAGGAAGG - Intergenic
1165605386 19:37099176-37099198 TGGGTATACATCCAAAGGAAAGG - Intronic
1165985022 19:39760819-39760841 TGGGTATATATCCAAAAGAAAGG + Intergenic
1166901192 19:46064792-46064814 TGGATATATACCCAAAAGAAAGG - Intronic
1168184718 19:54692233-54692255 TGGGTATAGATCGAAAGGAAAGG + Intronic
1168202089 19:54822976-54822998 TGGGTTTATATCCAAAGGAAAGG - Intronic
1168206898 19:54857031-54857053 TGGGTTTATATCCAAAGGAAAGG - Intronic
925500230 2:4495473-4495495 TGGATATACACCCCAAAGGATGG - Intergenic
925518988 2:4719934-4719956 TGGGTATATATCCAAAAGAAAGG + Intergenic
926487157 2:13475994-13476016 TGAATACACACTCAAAGGGAGGG - Intergenic
926870010 2:17405686-17405708 TGGACATTTATCCAAAGGAAAGG + Intergenic
927130780 2:20057565-20057587 TGGGTATTTATCCAAAGGGAAGG + Intergenic
927419393 2:22914311-22914333 TGGATATATACCCAAAAGAAGGG + Intergenic
927543712 2:23934431-23934453 TAGATATTCATCTCAAGGGAAGG + Intronic
927853915 2:26516273-26516295 TGGAGAGACATCCAAGGGGTGGG - Intronic
928067509 2:28181106-28181128 TGGGTATTTATCCAAAGGAAAGG + Intronic
930103951 2:47625543-47625565 TGGGTATATATCCAAAGGAAAGG - Intergenic
930197845 2:48527392-48527414 TTAATATACATCCAAGGGGAGGG - Intergenic
930343047 2:50141947-50141969 TGGGTATTTATCCAAAGGAAAGG + Intronic
930474239 2:51859667-51859689 TGGATATAGACCCAAAAGAAAGG - Intergenic
930617916 2:53613293-53613315 TGGATATTTATCCAAAGGAAAGG - Intronic
930678078 2:54225840-54225862 TGAATATACAACAACAGGGATGG + Intronic
932089522 2:68792769-68792791 TGGGTATACACCAAAAGGAAAGG - Intronic
932958085 2:76379455-76379477 TGTAAATACATCCAAGGGCAGGG + Intergenic
933080949 2:77985144-77985166 TGGATATACAAACAAAAGAAAGG + Intergenic
933593791 2:84262141-84262163 TGGGTATTTATCCAAAGGAAAGG + Intergenic
934307242 2:91837075-91837097 TGGATATATATCCAAAATAAAGG + Intergenic
934326015 2:92015638-92015660 TGGATATATATCCAAAATAAAGG - Intergenic
934464367 2:94246287-94246309 TGGATATATATCCAAAATAAAGG - Intergenic
935009313 2:99117093-99117115 CGGGTATACATCCAAAAGAAAGG - Intronic
935508592 2:103940143-103940165 TGGATATATATCCAAAAGATAGG + Intergenic
935576006 2:104711225-104711247 TGGATATATACCCAAAAGAAAGG - Intergenic
935629269 2:105199147-105199169 TGGATATATACCCAAAAGAAAGG + Intergenic
935686197 2:105685807-105685829 TGGGTATATAACCAAAGGAAAGG + Intergenic
935825957 2:106949832-106949854 TGGGTATTTATCCAAAGGAAAGG - Intergenic
935859055 2:107307898-107307920 TGGGTATTTATCCAAAGGAAAGG - Intergenic
936431637 2:112469749-112469771 TGGGTATACATCCAAAAGAAAGG + Intergenic
936470905 2:112797900-112797922 TCTATATACATCCAAAGGAGGGG + Intergenic
936696628 2:114957590-114957612 TGGATATAGTTCCAAAGGAATGG + Intronic
936885464 2:117305950-117305972 TGGCTATACATCCAAAAGAAAGG + Intergenic
936973888 2:118200666-118200688 TGGGTATATATCCAAAAGAAAGG - Intergenic
937129746 2:119500368-119500390 TGGGTATATATCCAAAAGAAAGG + Intronic
937297095 2:120816004-120816026 TGGATATAGTTCCAAGGGGGAGG - Intronic
937591811 2:123622519-123622541 TGGTTATATATCCAAAAGAAAGG + Intergenic
937613986 2:123897781-123897803 TGGGTATATATCCAAAAGAAAGG - Intergenic
937616586 2:123930169-123930191 TGGGTATACAACCAAAGGAAAGG - Intergenic
937729923 2:125216702-125216724 TGGATATTTATCCAAAGGAAAGG - Intergenic
937745311 2:125405161-125405183 TGGATATATATCCAAAAGAATGG - Intergenic
938261651 2:129900695-129900717 TGTGTATACATCCAAAAGAAAGG + Intergenic
938575788 2:132603031-132603053 TGGGTATTTATCCAAAGGAAAGG + Intronic
938619769 2:133038114-133038136 TTGGTATACATCCAAAAGAAAGG + Intronic
938693883 2:133817339-133817361 TGGGTATTTATCCAAAGGAAAGG + Intergenic
938800467 2:134758999-134759021 TGGGTATATATCCAAAAGAAAGG + Intergenic
940382832 2:153035650-153035672 TGGATATTTATGCAAAGGAAAGG + Intergenic
940476899 2:154174036-154174058 TGGGTATATATCCAAAAGAAAGG + Intronic
940542475 2:155038929-155038951 TAGGTATAAATCCAAAAGGAAGG + Intergenic
940553227 2:155188006-155188028 TGGCTATATATCCAAAGGAAAGG + Intergenic
940586807 2:155662085-155662107 TGGGTATATATCCAAAGGAAAGG + Intergenic
940734770 2:157438020-157438042 TGGGAATTCATCCAAAGGAAAGG + Intronic
940779005 2:157913726-157913748 TGGGTATATATCCAAAAGAAGGG + Intronic
941446920 2:165612912-165612934 TGGATATTTATCCAAAAGAAAGG - Intronic
941707871 2:168678829-168678851 TGGGTATGTATTCAAAGGGAAGG + Intronic
941799663 2:169644401-169644423 TGGGTATATATCCAAAAGAATGG + Intergenic
941861608 2:170287222-170287244 TGGGTATATATCCAAAGGAAAGG - Intronic
942273784 2:174303186-174303208 TAGGTATATATCCAAAGGAAAGG - Intergenic
942769606 2:179501235-179501257 TGGGTATATACCCAAAAGGAAGG + Intronic
943045053 2:182850720-182850742 TGGGTATATATCCAAAAGAAAGG - Intronic
943310957 2:186324206-186324228 TGGATATATATCCAAAAGAAAGG + Intergenic
943361975 2:186930675-186930697 TAGATATATATCCAAAAGAAAGG - Intergenic
943554400 2:189384249-189384271 TGAGTATACATCCAAAAGAAAGG - Intergenic
943659113 2:190538468-190538490 TGGGTATATATCCAAAAGAAAGG - Intergenic
944629504 2:201609196-201609218 TAGTATTACATCCAAAGGGAAGG + Intronic
944772484 2:202928468-202928490 TGGGTAAATATCCAAAGGAAAGG - Intronic
945031345 2:205666683-205666705 TGGGTATTTATCCAAAGGAAAGG - Intergenic
945211219 2:207384564-207384586 TGGGTATATATCCAAAAGAAAGG + Intergenic
945643714 2:212462749-212462771 TGGGTATATATCTAAAGGAAAGG + Intronic
945652069 2:212575163-212575185 TGGCTATATATCCAAAAGAAAGG - Intergenic
945737611 2:213619808-213619830 TGGATATTTATCCAAAGGAAAGG + Intronic
946127410 2:217575450-217575472 TGGGTATTTATCCAAAGGAAAGG + Intronic
946774212 2:223120579-223120601 TGGCTATACAGCCAAAGGAAAGG - Intronic
946906717 2:224424279-224424301 TGGGTATTTATCCAAAGGAAAGG + Intergenic
947330046 2:229019116-229019138 TGGATATATATACAAAGGAAAGG - Intronic
948324786 2:237105857-237105879 TGGATATTTATCCAAAGGAAAGG + Intergenic
948355494 2:237374098-237374120 TGTCTAGATATCCAAAGGGAGGG - Intronic
948834348 2:240618448-240618470 TGGATATACATCCAAATGACTGG + Intronic
1168945654 20:1754676-1754698 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1169180344 20:3560486-3560508 TGGGTATATATCCAAAAGAATGG - Intronic
1169304659 20:4478226-4478248 TGGGTATATATCCAAAAGAATGG + Intergenic
1169637158 20:7705240-7705262 TTGATACACATCCAAAGGAAAGG - Intergenic
1169836112 20:9881178-9881200 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1170058858 20:12238509-12238531 TGGGTATACAACCAAAGTAATGG + Intergenic
1170119782 20:12899512-12899534 TGGGTATACATCCATAGGAAAGG - Intergenic
1170147379 20:13191236-13191258 TGAGTATAGATCCAAAGGAAAGG + Intergenic
1170305970 20:14938187-14938209 TGGGTATATATCCAAAAGAAAGG - Intronic
1170886580 20:20344747-20344769 TGGGTATATATCCAAAAGAAAGG + Intronic
1171288156 20:23960140-23960162 TGGATATATATCCAAAGAAAAGG - Intergenic
1171933684 20:31253088-31253110 TGGGTATATATCCAAAGGAAAGG + Intergenic
1171999478 20:31761749-31761771 TGGGTATATATCCAAAAAGAAGG - Intronic
1173065983 20:39712107-39712129 TGGGTATATATCCAAAAGAAAGG - Intergenic
1173560336 20:44000518-44000540 TCAATTAACATCCAAAGGGAAGG + Intronic
1173773976 20:45687505-45687527 TGGGTATATACCCAAAGGAATGG - Intronic
1173946925 20:46959037-46959059 TGGGTATATACCCAAAGGAATGG - Intronic
1175343727 20:58253931-58253953 TGGGTATCTACCCAAAGGGAAGG + Intergenic
1176595417 21:8689429-8689451 TGGATATATATCCAAAATAAAGG - Intergenic
1177036581 21:16051207-16051229 TGGGTATATATCCAAAAGAAAGG + Intergenic
1177448997 21:21240453-21240475 TGGATATCCAGCCAAAGGGAAGG + Intronic
1177528139 21:22324749-22324771 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1177699389 21:24616218-24616240 TGGGTATATATCCAAATGAATGG + Intergenic
1178211817 21:30543325-30543347 CTGGTATACATCCAAAGGAAGGG - Intronic
1178220797 21:30657448-30657470 TGGGTATATATCCAAAGAAAAGG - Intergenic
1178691335 21:34752594-34752616 TGGATTTACATCCAGAAGCAGGG + Intergenic
1178986733 21:37311236-37311258 TGGGTATACACCCAAAAGAAAGG - Intergenic
1179010808 21:37554613-37554635 TGGACATACACCCAAGGGGCTGG + Intergenic
1179042251 21:37814425-37814447 TGGGTATATATCCAAAAGAAAGG + Intronic
1179454149 21:41487034-41487056 TGGGTTTATATCCAAAGGAAAGG + Intronic
1180278275 22:10666579-10666601 TGGATATATATCCAAAATAAAGG - Intergenic
1180585523 22:16885423-16885445 TGGATATATATCCAAAATAAAGG - Intergenic
1180628871 22:17213335-17213357 TGGGTATCTATCCAAAGGGAAGG + Intronic
1180667748 22:17528052-17528074 TGGGTATACACCCAAAAGAAAGG + Intronic
1180754836 22:18154059-18154081 TGAATATATATCCAAAGGAAAGG - Intronic
1181445021 22:22963792-22963814 TGGATATATACCCAAAAGTAAGG - Intergenic
1182173470 22:28257247-28257269 TGGGTATATATCCAAAAGAAAGG + Intronic
1182779575 22:32857154-32857176 TGGGTATGTATCCAAAGGAAAGG - Intronic
1183436731 22:37800539-37800561 TCGGTATATATCCAAAAGGAAGG - Intergenic
1185042017 22:48509304-48509326 TGGGTATTTATCCAAAGGAAAGG - Intronic
1185354258 22:50357298-50357320 TGCATATACATACATAGTGAGGG + Intronic
949918469 3:8983493-8983515 GGTAAATACACCCAAAGGGAGGG - Exonic
950043783 3:9937052-9937074 TGGATATAGACCCAAAAGAATGG - Intronic
950271563 3:11620241-11620263 TGGATTTACACCCAAAGGTCTGG + Intronic
950705335 3:14776022-14776044 TGGATGCACCTCCACAGGGAGGG - Intergenic
950741537 3:15056318-15056340 GAGATATACACCCAATGGGATGG + Intronic
950951173 3:17000917-17000939 TGGATATATATCCAAAAGAAAGG - Intronic
951222969 3:20088247-20088269 TGGATATATATCCAAAGAAAAGG - Intronic
951326574 3:21309276-21309298 TGGATATGTATCCAAAGGAAAGG + Intergenic
951446743 3:22790782-22790804 TGGGTATACATCCAAAAGAAAGG - Intergenic
951490209 3:23261969-23261991 TGGGTCTATATCCAAAGGAATGG - Intronic
951760545 3:26142888-26142910 TGGATATATACCCAAAAGAAAGG + Intergenic
951777808 3:26328825-26328847 TGGGTATATACCCAAAGGAAAGG + Intergenic
951797445 3:26556223-26556245 TGGATATATACCCAAAAGAAAGG + Intergenic
951965072 3:28373154-28373176 TGGATACATATCCAAAAGAAAGG - Intronic
952102613 3:30032394-30032416 TGGGTATATATCCAAAAGAAAGG - Intergenic
952206615 3:31186700-31186722 TGGATATACAACCTCAGGGAAGG + Intergenic
952251022 3:31654327-31654349 TGGATATCTATCCAAAAGGAAGG + Intergenic
952602085 3:35095891-35095913 TGGCTATATACCCAAAGGAAAGG - Intergenic
952727589 3:36604081-36604103 TGGGTATACACCCAAAAGAAAGG + Intergenic
954477254 3:50759096-50759118 TGCGTATATATCCAAAGGCAGGG - Intronic
954487359 3:50865646-50865668 TGGTTATATATCCAAAAGAAAGG - Intronic
954949269 3:54455088-54455110 TGGGTATATATCCAAAGGAAAGG - Intronic
956159864 3:66338937-66338959 GGTATATACATACAACGGGATGG - Intronic
956237421 3:67089674-67089696 TAGATATATATCCAAAAGAAAGG + Intergenic
956543375 3:70370307-70370329 CGGGTATTCATCCAAAGGAAAGG - Intergenic
957615806 3:82525193-82525215 TGGATATATATCCAAAAGAAAGG - Intergenic
957657236 3:83096146-83096168 TTGAGATTCATCCAAAGGGGAGG + Intergenic
957925920 3:86811233-86811255 TGGATATAGACCCAAAAGAAAGG + Intergenic
957941396 3:87009281-87009303 TGGGTATATATCCAAAGGAAAGG - Intergenic
958617988 3:96520728-96520750 TGGATATATACCCAAATGAAAGG + Intergenic
958843987 3:99242997-99243019 TGGGTATACATCCAAAAGAAAGG + Intergenic
959046572 3:101481132-101481154 TGGGTATTTATCCAAAGGAAAGG + Intronic
959250690 3:103939829-103939851 TGGATATTTATCCAAAGACAAGG - Intergenic
959655829 3:108803789-108803811 TGGGTATATATCCAAAAGAAAGG + Intergenic
960567730 3:119152638-119152660 TGGCTATATTTCCAAAGGAAAGG - Intronic
960616898 3:119604246-119604268 TGGGTATATATCCAAAAGAAAGG + Intronic
960893482 3:122476925-122476947 TGGGCATATATCCAAAGGAAAGG + Intronic
961769447 3:129238170-129238192 TGGATATATACCCAAAAGAATGG - Intergenic
961953659 3:130776944-130776966 TGGGTATATATCCAAAGAAAAGG + Intergenic
962801089 3:138891217-138891239 TGGATATATATCCAAAAGAATGG + Intergenic
962823548 3:139076932-139076954 TGGGTATATATCCAAAAGAAAGG + Intronic
962860854 3:139399744-139399766 TGGGTATATATTCAAAGGAAAGG + Intergenic
963436920 3:145282859-145282881 TGGGTATATATCAAAAGGAATGG - Intergenic
963592114 3:147273601-147273623 TGGATATATACCCAAAAGAAAGG + Intergenic
963677988 3:148337979-148338001 TGGGTGTATATCCAAAGGAAAGG - Intergenic
963686122 3:148436583-148436605 TGGGTATATATCCAAAAGAAAGG - Intergenic
964114478 3:153121392-153121414 TGGGTATATATCCAAAAGAAAGG - Intergenic
964421143 3:156504405-156504427 TGATTATATATCCAAAGGAAAGG - Intronic
964720969 3:159766627-159766649 TGGGTATACATGCAAAGTTAGGG + Intronic
964942943 3:162183583-162183605 TGAGTATATATCCAAAAGGAAGG + Intergenic
965064061 3:163822098-163822120 TGGGTATATATCCAAAAGAAAGG + Intergenic
965452119 3:168851089-168851111 TGGGTATATATCCAAAAGAAAGG - Intergenic
965579576 3:170253183-170253205 TAGATATACACCCAAAAGAAAGG - Intronic
965631487 3:170737824-170737846 TGGGTATTTATCCAAAGGAAAGG + Intronic
965676908 3:171207181-171207203 TGGATATATATCCAGAGGTGGGG + Intronic
967502281 3:190212620-190212642 TGGATATATACCCAAACGAAAGG + Intergenic
967571814 3:191037872-191037894 TGGATATATACCCAAAAGAAAGG - Intergenic
968237989 3:197049008-197049030 TCGATATATATACAAAGGAAAGG + Intronic
968292747 3:197551567-197551589 TGGGTATATACCCAAAAGGAAGG - Intronic
968389690 4:179923-179945 TGGATATACAAATAAAGGCAAGG - Intergenic
969864183 4:10062898-10062920 TGGGTATATATCCAAAGGAAAGG + Intergenic
970378899 4:15485473-15485495 TGGGTATATATCCAAAAGAAAGG - Intronic
970443050 4:16100811-16100833 TGGATATATACCCAAAAGAAAGG + Intergenic
971457191 4:26856471-26856493 TGAGTATATATCCAAAGGAATGG - Intergenic
971791374 4:31173978-31174000 TGGGTATATATCCAAAGAAATGG - Intergenic
972125011 4:35753697-35753719 TGGGTATATATCCAAAAGAAAGG - Intergenic
972429014 4:38962486-38962508 TGGGTATTTATCCAAAGGAAAGG - Intergenic
972521345 4:39860144-39860166 TGGATATATATCCAAAATAAAGG + Intronic
973035795 4:45404526-45404548 TGGTTACATATCCAAAGGAAAGG + Intergenic
973068159 4:45822780-45822802 TGGATATTTACCCAAAGGAAAGG + Intergenic
973145002 4:46814159-46814181 TGGGTATTTATCCAAAGGAAAGG + Intronic
974506179 4:62775647-62775669 TGGAGATACAGCTAAAAGGATGG + Intergenic
974648222 4:64720924-64720946 TGTACATACATGAAAAGGGAGGG - Intergenic
974979897 4:68942283-68942305 TGTATATATATCCAATGGAATGG - Intronic
975080000 4:70265691-70265713 TGGGTATACACCCAAAAGAAAGG + Intergenic
975977332 4:80114331-80114353 TTGATATATATCCAAAGGAAAGG - Intronic
976027318 4:80705109-80705131 TGGAGATACAGGCAAAGAGAAGG - Intronic
976042356 4:80902499-80902521 TGGATATATATCCATATGTATGG + Intronic
976073167 4:81265309-81265331 TGGGTATACAATCAAAGGAAAGG - Intergenic
976116302 4:81731398-81731420 TGGGTATATATCCAAAAGAAAGG + Intronic
976323378 4:83742646-83742668 TGGATATATACCCAAAAGAAAGG - Intergenic
976372540 4:84306066-84306088 TGGGTATTTATCCAAAGGAAAGG + Intergenic
976672415 4:87668217-87668239 TGGGAATTCATCCAAAGGAAAGG - Intergenic
976909493 4:90283823-90283845 TGGGTGTACATCCAAAAGAAAGG - Intronic
976961028 4:90973655-90973677 TGGGTATATATCCAAAGGAAAGG + Intronic
977012268 4:91652509-91652531 TGGCTATTTATCCAAAGGAAAGG - Intergenic
977112178 4:92972031-92972053 TGGGTATTTATCCAAAGGAATGG - Intronic
977367606 4:96090823-96090845 TGAGTATACATCCAAAAGAAAGG + Intergenic
977477716 4:97534481-97534503 TGAATATATATCCATATGGAAGG - Intronic
977496974 4:97788569-97788591 TGGATATATACCCAAAAGAAAGG - Intronic
977983375 4:103352917-103352939 TGGATATATATCTAAAAGAAAGG - Intergenic
978085767 4:104651072-104651094 TGCATATATATCCAAAGGAAAGG + Intergenic
978214085 4:106176675-106176697 TGGATATATGTCCAAAAGAAAGG - Intronic
978244566 4:106557451-106557473 TGGGTACACACCCAAAAGGAAGG + Intergenic
978855412 4:113388602-113388624 AGATTATAAATCCAAAGGGAAGG - Intergenic
979204043 4:118012834-118012856 TGAATATACACCAAAAAGGATGG + Intergenic
979280289 4:118859912-118859934 TAGGTATACATCCAAAAGAAAGG - Intronic
979493149 4:121353211-121353233 TGAGTATACATCCAAAAGAAAGG - Intronic
979499253 4:121419768-121419790 TGGATATACATTTAAAGGAAAGG - Intergenic
979763800 4:124439937-124439959 TGGGTTTATATCCAAAGGCAAGG - Intergenic
980096636 4:128498216-128498238 TGGGTATATATCCAAAGGAAAGG - Intergenic
980451355 4:132976767-132976789 TGGGTATTTATCCAAAGGAAAGG + Intergenic
980690627 4:136292060-136292082 TGGGTATCTATCCAAAGGAAAGG - Intergenic
980799236 4:137727554-137727576 TGGGTATATATCCAAAAGAAAGG - Intergenic
981285374 4:143011758-143011780 TGGATATATATTCAAAGGAAAGG - Intergenic
981791953 4:148548055-148548077 TGGATATACATCCAAAAGTAGGG - Intergenic
981880906 4:149611330-149611352 TGGGTATATATCCAAAGGAAAGG + Intergenic
981972592 4:150683399-150683421 TGAATTTAAAGCCAAAGGGAAGG - Intronic
981980737 4:150787935-150787957 TGGGTATATATCCAAAAGAAAGG - Intronic
982715174 4:158799281-158799303 TAGCTGTACATCCAAATGGAAGG + Intronic
983069558 4:163253207-163253229 TGGTTATACATCTGAAGGAAAGG - Intergenic
983154036 4:164322350-164322372 TGGGTATATATCCAAAAGAAAGG - Intronic
983164362 4:164457631-164457653 TGGATATTTATCCAAAGGAAAGG + Intergenic
983428365 4:167616427-167616449 TGGTTATTTATCCAAAGGAAAGG - Intergenic
983519970 4:168697864-168697886 TGGATATATACCCAAAAGAAAGG + Intronic
983521227 4:168711144-168711166 TGGATATTCATCTAAAGCTAGGG - Intronic
983595021 4:169456705-169456727 TGGGTATATATCCAAAAGAAAGG + Intronic
983910463 4:173233230-173233252 TGGGTATTTATCCAAAGGAAAGG - Intronic
984145916 4:176060734-176060756 TGGATATACTGTCAAAGGCAAGG + Intergenic
984357471 4:178682076-178682098 TGGATATACAGCATATGGGAGGG + Intergenic
984394470 4:179177153-179177175 TGGGTATATATCCAAAAGAAAGG - Intergenic
984634416 4:182095172-182095194 TGGGTATATATCCAAAAGAAAGG + Intergenic
985032284 4:185801313-185801335 TGGATATACATACAAAGGAAAGG - Intronic
985746154 5:1649206-1649228 TGGGTATTTATCCAAAGGAAAGG + Intergenic
985793129 5:1942523-1942545 TGGGTATATATCCAAAAGAATGG - Intergenic
985859998 5:2463328-2463350 TGGGTATTTATCCAAAGGAAAGG + Intergenic
986603947 5:9502920-9502942 TGGATATTTTCCCAAAGGGATGG + Intronic
986883902 5:12210860-12210882 TGGGCATTCATCCAAAGGAAAGG + Intergenic
988037478 5:25846361-25846383 TGGATATATATTCAAAGGAAAGG + Intergenic
988143685 5:27276148-27276170 TGGATATACCTCCAAAGCGTGGG + Intergenic
988315019 5:29614194-29614216 TGGTTATATCTCCAAAAGGAAGG - Intergenic
988341233 5:29974801-29974823 TGAGTATATATCCAAAGGAAAGG + Intergenic
988947154 5:36215933-36215955 TGGCTATTTATCCAAAGGAAAGG - Intronic
988955712 5:36316116-36316138 TGGATATACACCCAAAAGAAAGG - Intergenic
989060116 5:37402444-37402466 TGAGTATATATCCAAAGGAAAGG - Intronic
989658897 5:43777053-43777075 TGGGTATATGCCCAAAGGGAAGG - Intergenic
989683193 5:44053916-44053938 TGGATATATATCCAAAAGAAAGG + Intergenic
989753980 5:44929295-44929317 TTGGTATATATCCAAAGGAAAGG - Intergenic
989954425 5:50340768-50340790 TGGGTATATATCCAAATGAAAGG + Intergenic
990737884 5:58883470-58883492 TGGGTATATATCCAAAGGAATGG - Intergenic
990843545 5:60110648-60110670 TGGGTATCTATCCAAAGGAAAGG + Intronic
990932330 5:61107027-61107049 TGTATATTTATCCAAAGGAAAGG - Intronic
990955736 5:61336459-61336481 TGGATAAAAATCAAAAGGGCCGG + Intronic
991028280 5:62053942-62053964 TGGGTATTTATCCAAAGGAAAGG - Intergenic
991627294 5:68616738-68616760 TGGATGTTCATCCAAAGGAAAGG + Intergenic
991644192 5:68784970-68784992 TGGGTGTATATCCAAAGGAAAGG + Intergenic
991943563 5:71878473-71878495 TGGGTATATATCCAAAGGAAAGG - Intergenic
992169959 5:74091945-74091967 TGGATATTTATCCAAAGGAAAGG - Intergenic
992224221 5:74603737-74603759 TGGGTGTATATCCAAAGGAAAGG + Intergenic
992456519 5:76921379-76921401 TGAATACCCATCCAAAGAGAAGG - Exonic
992474696 5:77089793-77089815 TGGTTATTTATCCAAAGGAAAGG + Intergenic
992906578 5:81352252-81352274 TGGGTATACACCCAAAAGAAAGG + Intronic
992986942 5:82240166-82240188 TGGGTATATATCCAAAAGAAAGG + Intronic
993022828 5:82612225-82612247 TGGATATTTATCCAAACGAAAGG + Intergenic
993392939 5:87343716-87343738 TGGGTATATATCCAAAAGAAAGG + Intronic
993541038 5:89152009-89152031 TGGGTATATATTCAAAGGAAAGG - Intergenic
993950195 5:94165503-94165525 TGGGTATATACCCAAAGGAAAGG + Intronic
994226691 5:97260208-97260230 TGGGTATATATCCAAAAGAAAGG + Intergenic
994479497 5:100315873-100315895 TGGGTATATATCCAAAGGCAAGG + Intergenic
994771169 5:103983227-103983249 TGGGTATATATCCAAAGGAAAGG + Intergenic
994944663 5:106370932-106370954 TGGATATATACCCAAAAGAAAGG + Intergenic
994951525 5:106469862-106469884 TGGCTATACATCCAAAATAAAGG + Intergenic
994956183 5:106535758-106535780 TGGGTATACACCCAAAAGGCGGG - Intergenic
995116815 5:108490383-108490405 TGGGTATATATCCAAAAGAAAGG + Intergenic
995323655 5:110866134-110866156 TGGAGATACATCTATAAGGAGGG - Intergenic
995455818 5:112350971-112350993 TGGATATTTATCCAAAAGAAAGG - Intronic
995515105 5:112946688-112946710 TGGGTATATAACCAAAGGAAAGG + Intergenic
995558084 5:113351182-113351204 TGGATATATACCCAAAAGAAAGG + Intronic
995615340 5:113956513-113956535 TGGGTATATATCCAAAAGAAAGG - Intergenic
996073100 5:119157361-119157383 TGGATATCACACCAAAGGGACGG - Intronic
996089237 5:119334875-119334897 TGGGTAGAGTTCCAAAGGGAGGG + Intronic
996205928 5:120735365-120735387 TGGATATACATTCAAAAGTGGGG + Intergenic
996302333 5:122003546-122003568 TGGGTATATATCCAAAGGAAAGG - Intronic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
996373541 5:122778315-122778337 TGGGTAAATATCCAAAGGAAAGG - Intronic
996462169 5:123758458-123758480 TGGGTATATATCCAAAAGAAAGG - Intergenic
996641925 5:125765298-125765320 TGGGTATACACCCAAAGGAAAGG - Intergenic
996822002 5:127639961-127639983 TGGATATACATTTAAAAGAAAGG - Intergenic
997046758 5:130328605-130328627 TGGATATACATCCAAAATAAAGG - Intergenic
997219292 5:132146569-132146591 TAGGTACATATCCAAAGGGAAGG + Intergenic
999706758 5:154279920-154279942 TGGGTATATATCCAAAGAAAAGG + Intronic
1000108634 5:158085494-158085516 TGGGTATATATCCAAAGGAGAGG - Intergenic
1000432838 5:161170644-161170666 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1000433791 5:161182975-161182997 TGGGTATATATCCAAAAGAAAGG + Intergenic
1001739796 5:174043281-174043303 TGGATGTTCATCTAAAGGAAGGG - Intergenic
1003156589 6:3602581-3602603 TGGATTTACTTTCACAGGGAAGG + Intergenic
1003437614 6:6106862-6106884 TGGGTATATATCCAAAAGAAAGG - Intergenic
1004795463 6:19078639-19078661 TGGGTATATATCCAAAAGAATGG + Intergenic
1004850752 6:19696849-19696871 TGGGTATATATCCAAAGTAAAGG - Intergenic
1004885109 6:20043700-20043722 TGGGTATATACCCAAAGGAATGG - Intergenic
1004937472 6:20521841-20521863 TGGGTATATATCCAAAAGAAAGG - Intergenic
1005138934 6:22604266-22604288 TGGGCATATATCCAAAAGGAAGG - Intergenic
1005238226 6:23791136-23791158 TCTGAATACATCCAAAGGGAAGG - Intergenic
1005447961 6:25944894-25944916 TGGCTATTTATCCAAAGGGAAGG - Intergenic
1005604129 6:27458724-27458746 TGGGTATTTATCCAAAGTGAAGG + Intronic
1005880241 6:30052145-30052167 TGGGTATTTATCCAAAGGTAAGG - Intergenic
1006270510 6:32962617-32962639 TGGGTATATATCCAAAAGAAAGG + Intronic
1006959247 6:37911037-37911059 TGCGTATATATCCAAAGGAATGG - Intronic
1007138876 6:39551087-39551109 TGGGTATATATCCAAAAGAAAGG - Intronic
1008018327 6:46546777-46546799 TGAATATACACCCAAAAGAAAGG + Intergenic
1008202567 6:48609558-48609580 TGGATATTTATCCAAAAGAAAGG + Intergenic
1009266785 6:61565857-61565879 TGGGTATATATCCAAAAGCAAGG + Intergenic
1009391388 6:63147890-63147912 TGGATATATACCCAAAAGAAAGG + Intergenic
1009624253 6:66118125-66118147 TGTATATATATCCAAAAGAAAGG + Intergenic
1009657798 6:66568637-66568659 TGGATATATAGCTCAAGGGAAGG - Intergenic
1009674062 6:66793924-66793946 TGGGTACTCATCCAAAGGAAAGG + Intergenic
1009912084 6:69942895-69942917 GGGATATGTATCCAAAGGAAAGG - Intronic
1010134844 6:72539276-72539298 TGGATATATATTCAGAGGAAAGG - Intergenic
1010263482 6:73842573-73842595 TGGGTATACACCCAAAAGAAAGG - Intergenic
1010316895 6:74461977-74461999 TGGATATCTACCCAAAGGAAAGG - Intergenic
1010867390 6:80995930-80995952 TGGATATATACCCAAAAGAAAGG - Intergenic
1011102037 6:83733081-83733103 TGGGTATATACCCAAAGGAATGG - Intergenic
1011285273 6:85716135-85716157 TGGGTATATATCCAAAAGAAAGG - Intergenic
1011306073 6:85928349-85928371 TGGGTACATATCCAAAGGAAAGG - Intergenic
1011330136 6:86195442-86195464 TGGCTATATATCCAAAAGAATGG + Intergenic
1011387867 6:86816870-86816892 TGGGTATATATCCAAAGTAAAGG + Intergenic
1011446676 6:87448999-87449021 TGGGCATATATCCAAAGGAAAGG - Intronic
1011783526 6:90817935-90817957 TGGGTATATATCCAAAAGAAAGG - Intergenic
1011923174 6:92607809-92607831 TGGGTATATATCCAAAAGAAAGG + Intergenic
1012011767 6:93796839-93796861 TGGGTACATATCCAAAGGAATGG + Intergenic
1012176054 6:96086262-96086284 TGGATATAAATGCAAACGGAAGG - Intronic
1012214588 6:96566496-96566518 TGGGTATATATCCAAAGGAAAGG - Intronic
1012653112 6:101782701-101782723 TGGGTATGTATCCAAAGGAAAGG - Intronic
1012739076 6:102991107-102991129 TGGATATATATCCAAAAGAAAGG + Intergenic
1013257063 6:108397948-108397970 TGGGTATATATCCAAAAGAAAGG - Intronic
1013453899 6:110312347-110312369 TGGGTATATATCCAAAGGAAGGG + Intronic
1013476301 6:110510402-110510424 CTGATCTACACCCAAAGGGAGGG - Intergenic
1013534223 6:111048835-111048857 TGGATATATATCCAAAAGAATGG - Intergenic
1013558397 6:111280674-111280696 TGGGTGTATATCCAAAGGAAAGG - Intergenic
1013568421 6:111394134-111394156 TGGGTATTTATCCAAAGGAAAGG - Intronic
1013799699 6:113928643-113928665 TGGGTATATATCCAAAAGAAAGG - Intergenic
1013884914 6:114951584-114951606 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1014355391 6:120402541-120402563 TGGGTATATATCCAAAAGAAAGG - Intergenic
1014780794 6:125562252-125562274 TGGATATTTATTCAAAGGAAAGG - Intergenic
1015126124 6:129756783-129756805 GGGATCTACCTCCAAATGGAGGG - Intergenic
1015517761 6:134101352-134101374 TGAATATATATCCAAAAGAAAGG + Intergenic
1016116749 6:140295819-140295841 TGGATATTTATCCAAAGGATAGG + Intergenic
1016729422 6:147412472-147412494 TGGGTATACATCCAAAGAAAAGG + Intergenic
1017365798 6:153636182-153636204 TGGGTATATACCCAAAAGGAAGG - Intergenic
1017396660 6:154008410-154008432 TGGGTATAAACCCAAAAGGAAGG + Intergenic
1017651231 6:156584423-156584445 TGGATATATACCCAAAAGAAAGG + Intergenic
1018317430 6:162570462-162570484 TGGGTATATATCCAAAAGAAAGG + Intronic
1018550673 6:164994663-164994685 TGAATATTCATCCAAACGAAAGG - Intergenic
1018808005 6:167276344-167276366 TGGGTGTTCATCCAGAGGGAAGG - Intronic
1019255923 7:50826-50848 TGGACATTTATCCAAAGGAAAGG + Intergenic
1020664053 7:11017244-11017266 TGGGTATACATCCGAAAGAAAGG - Intronic
1020772820 7:12416768-12416790 TGGATATACATGCCAAAGAAAGG - Intergenic
1021061953 7:16124046-16124068 TGGTTATTTATCCAAAGGAAGGG - Intronic
1021367410 7:19796900-19796922 TGTATATTTATCCAAAGGAAAGG - Intergenic
1021623180 7:22567546-22567568 TGGGTATATATCCAAAAGAAGGG - Intronic
1022135576 7:27444955-27444977 TGGGTATATATCCAAAGAAAAGG + Intergenic
1022780065 7:33572436-33572458 TGTATATATATCCAAAAGAAAGG - Intronic
1023154773 7:37237744-37237766 TGTATATACATTGAAAGGTATGG + Intronic
1023727016 7:43153340-43153362 CGGATATACATCGACAGGAAAGG - Intronic
1024415336 7:49098738-49098760 TGGGTACACACCCAAAGGAAAGG + Intergenic
1025918967 7:65892282-65892304 TGGGTATACACCCAAAAGAAAGG - Intronic
1026066397 7:67077240-67077262 TGAATATACATCCAAAGGAAAGG - Intronic
1026710529 7:72735099-72735121 TGAATATACATCCAAAGGAAAGG + Intronic
1027524604 7:79251731-79251753 TAGGTATACACCCAAAGGAAAGG + Intronic
1027628194 7:80570280-80570302 TGGGTATTTATCCAAAGGAAAGG - Intronic
1027808590 7:82862446-82862468 TGGGTATATATCCAAAAGAAGGG + Intronic
1028091874 7:86712970-86712992 TGGTTATATATCCAAAAGGAAGG - Intronic
1028379976 7:90189257-90189279 TGGGTATATATCCAAAAGAAAGG - Intronic
1028386312 7:90257867-90257889 TGGGTATTTATCCAAAGGAAAGG - Intronic
1028492726 7:91431564-91431586 TGGATATTGGTCCAAAGGTAAGG - Intergenic
1028510179 7:91616357-91616379 TGTGTATATATCCAAAGGAATGG + Intergenic
1028632147 7:92946754-92946776 TAGATATATACCCAAAGGAAAGG - Intergenic
1028682166 7:93548030-93548052 TGGAAATACTTTCTAAGGGATGG + Intronic
1028773141 7:94650228-94650250 GGGAGATACATCACAAGGGAGGG + Intronic
1028904730 7:96140264-96140286 TGGGTGTACATCCAAAAGAATGG - Intronic
1030035771 7:105407239-105407261 TGGGTATACACCCAAAAGAAAGG + Intergenic
1030241752 7:107334059-107334081 TAGGTATATATCCAAAGGAAAGG + Intronic
1030294798 7:107912323-107912345 TGGGTATATATCCAAAAGAAAGG - Intronic
1030554281 7:111003850-111003872 TAGATATACATTCAATGGGGTGG - Intronic
1030875337 7:114806685-114806707 GGGAGTTACATACAAAGGGAAGG + Intergenic
1031065832 7:117104613-117104635 TGGATATATATCCAAAAGAAAGG + Intronic
1031214487 7:118872601-118872623 TGGATATATACCCAAAGGAGAGG + Intergenic
1031454013 7:121957265-121957287 AGGAGATACAGCCAAAGTGAAGG - Intronic
1031621079 7:123934486-123934508 TGGTTATATATCCAAAGGAAAGG + Intronic
1031653496 7:124321700-124321722 TGGATGTATATCCAAAAGAAAGG + Intergenic
1031801759 7:126255569-126255591 TGGGTATATATCCAAAAGAAAGG + Intergenic
1032773460 7:135084838-135084860 TGGGTATATATCCAAAAGGAAGG - Intronic
1032849211 7:135779038-135779060 TGGGTATATATCCAAAAGAAAGG + Intergenic
1032935586 7:136727747-136727769 TGGGTATATACCCAAAGGAAAGG + Intergenic
1033858285 7:145593019-145593041 TGAATATACATCTAAAGGAAAGG - Intergenic
1034722106 7:153302974-153302996 TGGGTATATATCCAAAGAAAAGG + Intergenic
1036364276 8:8105249-8105271 TGGGTATACATCCAAAAAAAAGG - Intergenic
1036596420 8:10216899-10216921 TGGGTATACACCCAAAAGAATGG - Intronic
1036634134 8:10537123-10537145 TGGGTATACGTCCAAAAGAAAGG + Intronic
1037149177 8:15615106-15615128 TGGTTATTTATCCAAAGGAAAGG + Intronic
1037168990 8:15867219-15867241 CAGCTATACATCCAAAGGAAAGG + Intergenic
1038352479 8:26790102-26790124 TGGGTATATAGCCAAAGGAAAGG + Intronic
1038378422 8:27067466-27067488 TGGTTATACATCCAAAAGAAAGG - Intergenic
1038449543 8:27631053-27631075 TGGGTACATATCCAAAGGAAGGG - Intergenic
1038690420 8:29756967-29756989 TGGATATATACACAAAGGCAGGG + Intergenic
1038871637 8:31501257-31501279 TGGGTATACACCCAAAAGAAAGG - Intergenic
1038900504 8:31837974-31837996 TGGGTATATATCCAAAGGAAAGG - Intronic
1039005641 8:33033849-33033871 TGGTTATTTATCCAAAGGTAAGG + Intergenic
1039173607 8:34778932-34778954 TGGGTATATATCCAAAGTGGGGG + Intergenic
1039342128 8:36662118-36662140 TGGACATAATTCCAAAGGAAAGG + Intergenic
1039367598 8:36947350-36947372 TGGTTATATATCCAAAGGAAAGG + Intergenic
1039644104 8:39261550-39261572 TGGGTATTTATCCAAAGGAAAGG - Intronic
1039675101 8:39654539-39654561 TGGATATACATCCAAAAGAGAGG - Intronic
1039749926 8:40469129-40469151 TGGGTATCTATCCAAAGGAAAGG + Intergenic
1039964741 8:42275781-42275803 TGGGTATCTATCCAAAGGAAAGG - Intronic
1040061371 8:43105988-43106010 TGGGTATATATCCAAAGGAAAGG - Intronic
1040069120 8:43175220-43175242 TGGGTATATATGCAAAAGGAAGG - Intronic
1040477392 8:47791848-47791870 TGGATATATACCCAAAAGAAAGG + Intronic
1040703696 8:50099487-50099509 TGGATATCTATCCAAAAGAAAGG - Intronic
1040912727 8:52537470-52537492 TGGGTATTTATCCAAAGGAAAGG + Intronic
1041207871 8:55516769-55516791 TGGGTACATACCCAAAGGGAAGG + Intronic
1041523500 8:58780119-58780141 TGGGTATATACCCAAAGGAAAGG - Intergenic
1041843827 8:62304102-62304124 CATATATACATCCTAAGGGATGG + Intronic
1042000469 8:64118031-64118053 TGGGTATTCATCTAAAGGAAAGG + Intergenic
1042099578 8:65260431-65260453 TGGGTATATATCCAAAAGAAAGG - Intergenic
1043179530 8:77069292-77069314 TGGATATATATCCAGAAGAAAGG - Intergenic
1043754592 8:83986936-83986958 TGGATATATACCCAAAAGAAAGG + Intergenic
1044104964 8:88193051-88193073 TGGGCATATATCCAAAGGAAAGG + Intronic
1044185535 8:89246355-89246377 TGGATATTTATCCAAAGGAAGGG - Intergenic
1044218609 8:89643652-89643674 TGGATATATATTCGAAGTGAAGG + Intergenic
1044390678 8:91647102-91647124 TGGGTATACATCCCAAAGAAAGG - Intergenic
1044394676 8:91696864-91696886 TGGGTATATACCCAAAGGAATGG - Intergenic
1044478711 8:92659680-92659702 TGGACATTCTTCCGAAGGGAGGG - Intergenic
1045691373 8:104763255-104763277 TGGATCCAGATCCCAAGGGAGGG + Intronic
1045774294 8:105783882-105783904 TGGATATATATTCAAAAGAAAGG - Intronic
1045807277 8:106178342-106178364 TGGGTATATATCCAAAAGAAAGG - Intergenic
1045949146 8:107831839-107831861 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1046058140 8:109103048-109103070 TGGATGCACATCCACAGGGCAGG + Intronic
1046147678 8:110182537-110182559 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1046167523 8:110456723-110456745 TGGGTATACATCCAAAGGAAAGG + Intergenic
1046346268 8:112932092-112932114 TGGGTATTCATCCAAAGGAAAGG + Intronic
1047504482 8:125468227-125468249 TGGAGATGCATCCAAAGACATGG + Intergenic
1047667793 8:127111163-127111185 TGGGTATATATCCAAAGGATTGG + Intergenic
1048108240 8:131436611-131436633 TTGATATTTATCCAAAGGAAAGG + Intergenic
1050300832 9:4256842-4256864 TGAATATACACCCAAAGGAAAGG + Intronic
1050806736 9:9689980-9690002 TGGATATACATCCAAAAGAAAGG - Intronic
1050966713 9:11813270-11813292 TGGGTATATAGCCAAAGGAATGG - Intergenic
1051073174 9:13198090-13198112 TGGGTATATATCCAAAAGAAAGG - Intronic
1051131656 9:13868462-13868484 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1051252081 9:15170203-15170225 TGGATATACATCCTCAGTGTTGG + Exonic
1051573582 9:18587967-18587989 TGGTTATATATCCAAATGAAAGG - Intronic
1051625990 9:19100575-19100597 TGGGTATATATCCAAAAGGAAGG + Intronic
1051927128 9:22342321-22342343 TGGATGTACATAAAAAGTGAAGG + Intergenic
1051953763 9:22664566-22664588 TGGGTATACATCCAAAAGAAAGG - Intergenic
1052531766 9:29693986-29694008 GGGATATATATCCAAAAGAAAGG + Intergenic
1052644482 9:31215424-31215446 TGGATATATATCCCAAAGAAAGG - Intergenic
1053086043 9:35223188-35223210 TGGGTATTTATCCAAAGGAAAGG - Intronic
1053180829 9:35968300-35968322 TGGGTATATATCCAAAGGAAAGG - Intergenic
1053694450 9:40623061-40623083 TGGATATATATCCAAAATAAAGG - Intergenic
1053941444 9:43253463-43253485 TGGATATATATCCAAAATAAAGG - Intergenic
1054305695 9:63422285-63422307 TGGATATATATCCAAAATAAAGG - Intergenic
1054726812 9:68660583-68660605 TGGACATTTATCCAAAGAGAAGG + Intergenic
1055524577 9:77117763-77117785 TGGGTATATATCCAAAGGAAAGG + Intergenic
1055908707 9:81322771-81322793 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1056040018 9:82655632-82655654 TGGATACATATCCAAAAGAAAGG - Intergenic
1056344449 9:85676684-85676706 TGGGTATATATCCAAACGAAAGG + Intronic
1056593240 9:87981981-87982003 TGGATATTTATCCAAAGGAAAGG + Intergenic
1056830229 9:89910980-89911002 TGGGTATACAGCCAAAAGAAAGG - Intergenic
1056870658 9:90274743-90274765 TGGATACTCATGCAGAGGGATGG - Intergenic
1057174050 9:92982479-92982501 TGGACATTTATCCAAAGGAAGGG - Intronic
1057241101 9:93410102-93410124 TAGATACAGATCCAAAAGGAAGG - Intergenic
1057433750 9:95020351-95020373 TAGACACACATCCAAAGGGAGGG + Intronic
1057492598 9:95533212-95533234 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1057932274 9:99204829-99204851 TGGCTATTTATCCAAAGGAAAGG - Intergenic
1058016824 9:100042555-100042577 TAGGTATACACCCAAAGGAAAGG + Intronic
1058129847 9:101239213-101239235 TGGGTATTCATCCAAAGGAAAGG - Intronic
1058147727 9:101430269-101430291 TGGATGTACATGCAGAAGGAGGG + Intronic
1058168204 9:101645487-101645509 TGGGTATATATCCAAAAGAAAGG - Intronic
1058371043 9:104268038-104268060 TGGGTATCCATCCAAAGAAAAGG + Intergenic
1058716264 9:107724557-107724579 TGGGTATATATCCAAAAGAAAGG + Intergenic
1059437043 9:114283249-114283271 TGGAAATACTGCCTAAGGGAGGG - Intronic
1059608720 9:115868406-115868428 TGGATATTTATTCAAAGGAAAGG + Intergenic
1060164286 9:121396737-121396759 TGGGTATTTATCCAAAGGAAAGG - Intergenic
1061981622 9:134107824-134107846 TGGGTATATATCCAAAAGAAAGG + Intergenic
1062174896 9:135156075-135156097 TGGCTGTGCAACCAAAGGGAGGG - Intergenic
1062717066 9:138016418-138016440 TGGAGCTGCATCCAAAAGGAAGG + Intronic
1062728199 9:138091033-138091055 TGGGTATATATCCAAACGGAGGG + Intronic
1186131957 X:6477544-6477566 TGGGTATACACCCAAAAGAAAGG - Intergenic
1186259272 X:7758953-7758975 TGGATATATATCCAAAGGAAGGG - Intergenic
1186782299 X:12925098-12925120 TGGGTATACACCCAAAAGAAAGG + Intergenic
1186911158 X:14167970-14167992 TGGATATATACCCAAAAGAAAGG - Intergenic
1186920904 X:14279128-14279150 TGGGTATTCATCCAAAGGAAAGG + Intergenic
1186959448 X:14719694-14719716 TGGCTCTATATCCAAAGGAAAGG + Intronic
1186962927 X:14757211-14757233 TGGATCTACATCCCACGGAATGG + Intergenic
1186983417 X:14984138-14984160 TGGGTATACATACAAAAGAAAGG + Intergenic
1187090763 X:16094170-16094192 TGGATATATACCCAAAGGAAAGG - Intergenic
1187291136 X:17954333-17954355 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1187613122 X:20964009-20964031 TGGATATATACCCAAAAGAAAGG + Intergenic
1187660023 X:21534430-21534452 TGGGTATAGGTCCAAAGGAAAGG - Intronic
1187750012 X:22452313-22452335 TAGGTATGCATCCAAAGGAAAGG + Intergenic
1187843961 X:23516980-23517002 TGGGTATACACCCAAAAGAATGG - Intergenic
1187845379 X:23531063-23531085 TGGGTATACACCCAAAAGAATGG + Intergenic
1187847638 X:23557171-23557193 TGGATTCACATCCAAAGGCTAGG + Intergenic
1188045008 X:25415548-25415570 TGGAAGTTCATCCATAGGGAGGG + Intergenic
1188064500 X:25641935-25641957 TGGGTATATATCCAAAAGAAAGG - Intergenic
1188077168 X:25792222-25792244 TGGATATATATCCAAAAGAAAGG + Intergenic
1188095986 X:26022283-26022305 TGGAAATAAATCCTAATGGATGG - Intergenic
1188114555 X:26226975-26226997 TTGATATGCATCCAAAGTGAAGG - Intergenic
1188121495 X:26314200-26314222 TGGATATATATCCAAAGGAAAGG - Intergenic
1188530857 X:31139313-31139335 TGGATATCTACCCAAAGGAAAGG + Intronic
1188737080 X:33730265-33730287 TAGGTATACATCCAAAAGAAAGG - Intergenic
1188996578 X:36893670-36893692 TGGGTATATATCCAAAAGAAAGG + Intergenic
1189125998 X:38447051-38447073 TGGGTATATATCCAAAAGAAAGG - Intronic
1189722852 X:43938369-43938391 TGGAATTAGATTCAAAGGGATGG - Intergenic
1189868342 X:45354763-45354785 TAGATATATATCCAAAAGAAAGG - Intergenic
1189880739 X:45488933-45488955 TGGTTGTATATCCAAAGGAAAGG + Intergenic
1190020270 X:46867994-46868016 TGGGTATAGATCCAAAAGCAAGG - Intronic
1190482923 X:50895479-50895501 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1190621004 X:52287195-52287217 TGGGTATATATCCAAAAGGAAGG - Intergenic
1190759946 X:53430812-53430834 TGGAGATAAATGCCAAGGGAGGG + Intronic
1190898419 X:54644109-54644131 TAGGTATACATCCAAAAGAAAGG - Intergenic
1190973192 X:55372651-55372673 TGGGTATATATCCAAAAGAAAGG - Intergenic
1191051084 X:56193465-56193487 TGGATATATAACCAAAAGAAAGG + Intergenic
1191058933 X:56274017-56274039 TGGTTATATATCCAAAAGAAAGG - Intronic
1191118531 X:56877099-56877121 TGGGTATATATCCAAAAGAAAGG - Intergenic
1191143396 X:57138556-57138578 TGGGTATATATCCAAAAGAAAGG - Intergenic
1191686487 X:63897786-63897808 TGGGTATATATCCAAAAGAAAGG + Intergenic
1191711294 X:64152441-64152463 TGGAGATGCAGCCAAATGGAAGG + Intergenic
1191767777 X:64718818-64718840 TGGTTATATATCCAAAGGAAAGG + Intergenic
1192060974 X:67825500-67825522 TGGATATACACTCAAAAGAAAGG + Intergenic
1192137821 X:68620701-68620723 TGGATATATACCCAAAAGAAAGG - Intergenic
1192375071 X:70550897-70550919 TGGATATATACCCAAAAGAAAGG + Intronic
1192671303 X:73144795-73144817 TGGATATATACCCAAAAGAAGGG - Intergenic
1192762805 X:74112183-74112205 TGGGTATTTATCCAAAGGAAAGG + Intergenic
1192786135 X:74337493-74337515 TGGGTATATATCCAAAGGAAAGG - Intergenic
1192819935 X:74634603-74634625 TGGGTATATATCCAAAAGAAAGG - Intergenic
1192893076 X:75410731-75410753 TGGGTACACATCCAAAAGAAAGG + Intronic
1193022996 X:76812818-76812840 TGGGTATATATCCAAAAGAAAGG + Intergenic
1193193770 X:78605471-78605493 TGCATGTATATCCAAAGGAAAGG + Intergenic
1193414529 X:81205645-81205667 TGGGTATATATCCAAAAGAAAGG - Intronic
1193490086 X:82138702-82138724 TGGGTATATATCCAAAAGAAAGG + Intergenic
1193504367 X:82322987-82323009 TGGATATATACCCAAAAGAAAGG - Intergenic
1193550507 X:82886776-82886798 TGGGTATATATCCAAAAGAAAGG - Intergenic
1193655884 X:84197077-84197099 TGGGTATACATCCCAAAGAAAGG - Intergenic
1193908586 X:87273999-87274021 TGGATATACATTCAAACAGCTGG + Intergenic
1194301012 X:92186004-92186026 TGGGTATATATCCAAAGGAAAGG + Intronic
1194321374 X:92450442-92450464 TGAACATACATCCAAAGGCAAGG - Intronic
1194418402 X:93641574-93641596 TGGGTATATACCCAAAGGAAAGG + Intergenic
1194537497 X:95123210-95123232 TGGGTATATATCCAAAAGAAAGG + Intergenic
1194559865 X:95406823-95406845 TGGGTATGCACCCAAAGGAATGG + Intergenic
1195205010 X:102589781-102589803 TTGATATATATCCAAAAGAAAGG - Intergenic
1195224040 X:102773925-102773947 TGGATATATACCCAAAAGAAAGG - Intergenic
1195501533 X:105606548-105606570 AGGATATATATCCAAAGGAAAGG + Intronic
1195602063 X:106760637-106760659 TGGGTATCTATCCAAAGGAATGG + Intronic
1195838105 X:109142666-109142688 TGGGTATATATCCAAAAGAAGGG + Intergenic
1195911636 X:109894126-109894148 TGGGTATATACCCAAAGGCAAGG - Intergenic
1196119363 X:112032393-112032415 TGGATATGTATCCAAAAGAAGGG + Intronic
1196470855 X:116024596-116024618 TGGGTATATATCCAAAATGAAGG + Intergenic
1196661150 X:118270245-118270267 TGGATATTTATCCAAAGGAAAGG + Intergenic
1197021014 X:121688775-121688797 TGGGTATAAATCCAAAAAGAGGG - Intergenic
1197180265 X:123527869-123527891 TGGGTATTTATCCAAAGGAATGG - Intergenic
1197286239 X:124598383-124598405 TGGATATATATCCCAAAGAAAGG + Intronic
1197599618 X:128512853-128512875 TGGGTATACATCCAAAGGAAAGG + Intergenic
1197876090 X:131108728-131108750 TGGATATATACCCAAAAGAAAGG - Intergenic
1198007501 X:132511952-132511974 TGGGTATATATCCAAAAGAAAGG + Intergenic
1198428516 X:136543168-136543190 TGGATATTCATCCAAAGACTAGG + Intronic
1198556960 X:137805350-137805372 TGGGTATATATCCAAAAGAAAGG - Intergenic
1198581450 X:138069417-138069439 TGGGTATATATCCAAAAGAAAGG - Intergenic
1198634972 X:138687646-138687668 TGGGTATATATCCAAAAGAAAGG + Intronic
1198813090 X:140556183-140556205 TGGATATTTATCCAAAAGAAAGG + Intergenic
1199017878 X:142840555-142840577 TGGATATACACCCAAAAGAAGGG - Intergenic
1199207881 X:145170305-145170327 TGGGTATATATCCAAAGAAATGG - Intergenic
1199266706 X:145836564-145836586 TGGGTATATAGCCAAAGGAAAGG - Intergenic
1199378460 X:147139835-147139857 TGGATATATATCCAAAAGAAAGG - Intergenic
1199474973 X:148235077-148235099 TGGGTATACACCCAAAAGAAAGG + Intergenic
1199800342 X:151244880-151244902 TGGGTATATATCCAAAAGAAAGG - Intergenic
1200328758 X:155271859-155271881 TGGGTATATATCCAAAAGAAAGG - Intergenic
1200629544 Y:5563914-5563936 TGAACATACATCCAAAGGCAAGG - Intronic
1201192256 Y:11454972-11454994 TGGATATATATCCAAAATAAAGG - Intergenic
1201209402 Y:11665663-11665685 TGGAAATGAATACAAAGGGATGG + Intergenic
1201603483 Y:15758548-15758570 TGGGTATACATCCAAAGGAAAGG + Intergenic
1201713422 Y:17017141-17017163 TGGGTACATATCCAAAGGAATGG + Intergenic