ID: 1069236136

View in Genome Browser
Species Human (GRCh38)
Location 10:66076587-66076609
Sequence AACCCACTGGGTGTTAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069236136_1069236141 25 Left 1069236136 10:66076587-66076609 CCCCTCTTAACACCCAGTGGGTT 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1069236141 10:66076635-66076657 ATTTTATTATAAAACTTTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069236136 Original CRISPR AACCCACTGGGTGTTAAGAG GGG (reversed) Intronic
902640970 1:17765915-17765937 AACTCCCTGGGAGTTGAGAGAGG - Intronic
906415430 1:45618125-45618147 AAAGCACTGCATGTTAAGAGGGG + Exonic
906576802 1:46898530-46898552 AACCCACTGTATGTTCACAGTGG + Intergenic
906724293 1:48032611-48032633 AGCCCACAGTGTGTTAAGACAGG - Intergenic
916875481 1:168964071-168964093 AGCCCACTGATTGTTCAGAGGGG - Intergenic
917946386 1:179975960-179975982 AACCCATCAGGAGTTAAGAGAGG + Intronic
920455923 1:206101078-206101100 AAGCCAGAGGGTGTTAAGAGAGG - Intronic
924202152 1:241671729-241671751 AAACCCCAAGGTGTTAAGAGTGG - Intronic
1064457771 10:15504526-15504548 AAAACACTGTGTGTTCAGAGAGG - Intergenic
1067101719 10:43339068-43339090 AACAGAATGGATGTTAAGAGGGG + Intergenic
1068302573 10:55163286-55163308 AACCCATTGGGTGGTTAGATAGG + Intronic
1069236136 10:66076587-66076609 AACCCACTGGGTGTTAAGAGGGG - Intronic
1069558288 10:69412240-69412262 AACCCACTGGGTGATTATAATGG + Intronic
1071950717 10:90700250-90700272 AGCCCATTGGGTGATAATAGAGG + Intergenic
1074404228 10:113166997-113167019 ATCCCACTGGGAGTTCAAAGGGG - Exonic
1076921957 10:133458929-133458951 ATCCCACTGGGTGTGAAGGAAGG + Intergenic
1077166396 11:1141372-1141394 AACCCCTGGGGTGTTAAGAGAGG + Intergenic
1077401361 11:2359588-2359610 AGCTCACTGGGTGATGAGAGGGG - Intergenic
1090600465 11:128364571-128364593 AATCTACTGGGTGAAAAGAGAGG - Intergenic
1090664285 11:128904728-128904750 CACCCAGTGGGTGTTGAGTGGGG + Intronic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1094234148 12:28144342-28144364 ACCCCACAGGCTGTTAAGATTGG + Intronic
1096129284 12:49144823-49144845 AAACCACAGGAGGTTAAGAGTGG + Intergenic
1096407444 12:51354245-51354267 AACCCACTGGGTGGCAAGGCAGG - Exonic
1099832224 12:87858184-87858206 AACCCACAGGGTATTAAGTTGGG - Intergenic
1102117943 12:110417777-110417799 AACCCACTAAGAGTTAAAAGAGG + Intergenic
1102225750 12:111227219-111227241 TACCGACTGGGTGTCAGGAGCGG + Intronic
1107889458 13:44901544-44901566 AACACACTGGGTGTGTTGAGGGG + Intergenic
1109548524 13:63860710-63860732 AACCCTCTGGCTGTCAAAAGTGG - Intergenic
1113123889 13:106955073-106955095 ACCCCACTAGGTATTAGGAGTGG + Intergenic
1113402656 13:110008396-110008418 AACTCACTGAGTGTCAAAAGAGG - Intergenic
1114734201 14:25026569-25026591 AACTCACTTGGTGGTAAGATCGG - Intronic
1120088645 14:80305675-80305697 AACACACTGGATGCAAAGAGGGG + Intronic
1124039818 15:26091102-26091124 AACCCACTGGGTGGTTACACAGG - Intergenic
1129600939 15:76997716-76997738 ACCCCTCTGGGAGATAAGAGGGG - Intronic
1130070757 15:80644994-80645016 AGCTTACTGGGTGATAAGAGAGG + Intergenic
1130147548 15:81285825-81285847 AACCCAGTGGGTGTTACCTGTGG - Exonic
1130617875 15:85429653-85429675 AAACCATTGGCTGTTCAGAGTGG + Intronic
1133225529 16:4338705-4338727 GGCCCACTGGGTGTTAGGGGTGG - Exonic
1134355030 16:13474286-13474308 AAACCACTGGGTGTTGAGATCGG - Intergenic
1137605012 16:49781430-49781452 AACCCACTGCGAGTTCAGCGTGG + Intronic
1138606688 16:58094341-58094363 AACCCAGTGGCTATTGAGAGGGG - Intergenic
1138764315 16:59582987-59583009 AAACCACAGGTTGTTAAGTGTGG - Intergenic
1144489634 17:15697383-15697405 AACCCACTGGAAGGTAAGTGTGG + Intergenic
1144911331 17:18684571-18684593 AACCCACTGGAAGGTAAGTGTGG - Intergenic
1145724648 17:27107357-27107379 AACCCATTGGGTGGTCAGATAGG - Intergenic
1146473403 17:33142390-33142412 AAGCAGCTGGGTGATAAGAGTGG - Intronic
1149010882 17:51855000-51855022 AACCAAATGGATGGTAAGAGGGG - Intronic
1151597243 17:75086069-75086091 AACCCACTGGGTGGTTACAGTGG + Intergenic
1153662029 18:7333629-7333651 ACCCCACTTGGTGAGAAGAGGGG + Intergenic
1156188367 18:34689910-34689932 AAGCCACTGGGAGTTCAGACTGG - Intronic
1156259236 18:35429171-35429193 AACCCCCAGGGTGTCAAGGGAGG - Intergenic
1157271745 18:46281668-46281690 AACCCACTGGGAGTCTAGACTGG + Intergenic
1157787205 18:50494712-50494734 ACCCCACTGGGGGTTGAGAGTGG + Intergenic
1168315692 19:55483855-55483877 AACCTGCTGGTTGTTCAGAGCGG + Exonic
925101393 2:1249425-1249447 AACCCACAGTCTATTAAGAGAGG - Intronic
927594820 2:24387139-24387161 AACCCACTGGGTGATTACAATGG - Intergenic
930049768 2:47205928-47205950 AGCACACTGGGAGTTAGGAGTGG + Intergenic
931897991 2:66755014-66755036 AAGCCACTGTGTGTTCAGAATGG - Intergenic
941596145 2:167479699-167479721 AACCCATTGGGTGATTACAGTGG - Intergenic
942642050 2:178071324-178071346 AAGCCATTGGGTGTTAAGAAAGG + Intronic
943833506 2:192490346-192490368 AGCCCACTGGGTGATGATAGGGG + Intergenic
946548844 2:220777828-220777850 AACCCACTGGTTTTCAAGTGAGG - Intergenic
948055081 2:235005065-235005087 ATCCCCCTGGGTGTTAACACAGG + Intronic
1168904117 20:1390540-1390562 AGCCCACTGGGTCCTAAGAAGGG - Intronic
1172701976 20:36859218-36859240 AACCCACTGGGTGTGGATGGAGG - Intronic
1174976216 20:55338497-55338519 AACCTACTGGATTTTAAGATGGG + Intergenic
1178392498 21:32210731-32210753 AACCCACTCATTGTTAATAGAGG + Intergenic
1179242547 21:39604941-39604963 ATCCCACTGGGTGGGATGAGTGG - Intronic
1181682387 22:24504545-24504567 AACCCACTGAGTGCCTAGAGTGG - Intronic
1182252649 22:29013629-29013651 AACCAAAATGGTGTTAAGAGAGG + Intronic
951638828 3:24811129-24811151 AACCAGTTGGCTGTTAAGAGTGG - Intergenic
951638935 3:24812290-24812312 AACCAGTTGGCTGTTAAGAGTGG + Intergenic
956142559 3:66160360-66160382 TACCCACTGGCTGTTTGGAGTGG - Intronic
956753219 3:72361466-72361488 AACCCACCGGGAACTAAGAGAGG - Intergenic
960494632 3:118359958-118359980 GACCCATTGGGTGATAACAGGGG + Intergenic
961333227 3:126155126-126155148 AGCCCACAGGGAGATAAGAGTGG - Intronic
961552005 3:127674719-127674741 ATTCGACTGGGTGGTAAGAGAGG - Intronic
963420675 3:145057145-145057167 AGCCCAATGGGTGATAATAGGGG - Intergenic
963993141 3:151676632-151676654 AACCCACTGGGTGGTTACAGTGG + Intergenic
966277640 3:178194704-178194726 AAACCACTGGGTGTTTAAAATGG + Intergenic
969302015 4:6302656-6302678 AACACACTTGGTATTCAGAGTGG - Exonic
970204282 4:13640551-13640573 AACAAACAGGCTGTTAAGAGAGG + Intergenic
970610654 4:17722083-17722105 GACTCACTGGGTGTGGAGAGGGG + Intronic
972658261 4:41087963-41087985 AACCAAGTCGGTGTTAAGAATGG + Intronic
974975577 4:68887320-68887342 AGCCCATTGGGTGATAACAGGGG + Intergenic
979480946 4:121216704-121216726 AAACCACTGGGTGTAAACACAGG + Intronic
983198558 4:164835714-164835736 AACCCAAAGGGTGATAGGAGAGG + Intergenic
984027287 4:174558411-174558433 AAACCACTGGAAGTTAGGAGAGG - Intergenic
984278019 4:177633751-177633773 ATTTCACTGGGTGTTAAAAGTGG - Intergenic
986614646 5:9603980-9604002 AACACACTGGGGAATAAGAGGGG + Intergenic
999315917 5:150583890-150583912 TACCCACTGGGAGTGACGAGGGG + Intergenic
1000066304 5:157695588-157695610 AACCCACTCTGTCTTAGGAGAGG - Intergenic
1003300750 6:4880199-4880221 AGCTCACTGGTTGCTAAGAGAGG - Intronic
1003378006 6:5596953-5596975 ATCCCACAGGGTGTCACGAGGGG - Intronic
1004359116 6:14955240-14955262 AACCCATTGGGTGGTTACAGGGG + Intergenic
1007497164 6:42268215-42268237 ATCCCACTGGGGGATAGGAGGGG + Exonic
1009285976 6:61818018-61818040 AAGCCTCTGGGTTTTAAGACGGG - Intronic
1012573205 6:100757989-100758011 AACTCACTGTGTGTGAAGACTGG + Intronic
1013709300 6:112878748-112878770 AACACACTTAGTGTTAAGATTGG + Intergenic
1016400958 6:143679215-143679237 AACCCACTGGGTATAAAGTGGGG - Intronic
1016878330 6:148885622-148885644 AGCCCACTTGGTGTTCACAGTGG - Intronic
1017445387 6:154502884-154502906 AACACGCTGGGTGAAAAGAGAGG + Intronic
1030145326 7:106347716-106347738 AACCCACTGAGTGTGCACAGTGG + Intergenic
1031682141 7:124688146-124688168 AATCCATTGGGTGTTGACAGGGG - Intergenic
1033581107 7:142736646-142736668 AACTCACTGGGTACTCAGAGTGG - Intergenic
1033711536 7:143951102-143951124 ATCCCCCTTGGTGTTAAGTGAGG - Intergenic
1037764097 8:21761266-21761288 AACCCACTGTGTGTAAAGTAAGG + Intronic
1038038607 8:23706140-23706162 AGCACACTGGGTGTCAGGAGAGG + Intronic
1039454844 8:37699517-37699539 TAGCCACTGGGTGTTAGGGGCGG - Exonic
1040117462 8:43639733-43639755 AACCTACTGAGTGTAAAGAGAGG - Intergenic
1040139322 8:43892534-43892556 AACCTACTGGATGTAAAGAACGG - Intergenic
1040347244 8:46516897-46516919 AACCTACTGAGTGTAAAGAAAGG - Intergenic
1042667978 8:71228405-71228427 AAATCATTGGGTGTTAAAAGGGG + Intronic
1044044159 8:87409693-87409715 AAGCCCCTGGGTTTTCAGAGTGG - Intronic
1045903572 8:107314576-107314598 AAGCCACTGGGTTTTATGAAAGG + Intronic
1046024374 8:108704387-108704409 AACCCAATGCAGGTTAAGAGCGG + Intronic
1047864983 8:129013380-129013402 GACCCTCTGGGTTTGAAGAGAGG + Intergenic
1048563096 8:135563797-135563819 AAGCCACCGAGTGTTAGGAGAGG - Intronic
1049268956 8:141684100-141684122 TTCCCACTGGGTGTGAAGGGTGG - Intergenic
1052899737 9:33782134-33782156 AACTCACTGGGTACTCAGAGTGG - Intronic
1057187212 9:93063510-93063532 ACCCAACTGGGGGCTAAGAGGGG + Intronic
1057514914 9:95712823-95712845 AAACCACTGCGTTTTAAGGGAGG + Intergenic
1058239156 9:102534725-102534747 AACCCTCTGGAAGTTAAGAGGGG + Intergenic
1188879262 X:35471757-35471779 AAACCACTGGGTGAAAAAAGAGG - Intergenic
1191219020 X:57965749-57965771 AACCCACTCTGTGTTAGGAGAGG + Intergenic
1191861411 X:65668649-65668671 ACCCCACTGGCTGTTACGAGAGG + Intronic
1194839960 X:98727930-98727952 AACCCACTGGGGGTTGGGGGAGG - Intergenic
1195614663 X:106902935-106902957 ATCCCGCTGGGTGGCAAGAGGGG - Intronic
1196975253 X:121151903-121151925 AACCCACTCTGTCTTAAGAGAGG - Intergenic
1200136517 X:153877723-153877745 AGCCCCCTGGGGGTCAAGAGAGG + Intronic