ID: 1069238593

View in Genome Browser
Species Human (GRCh38)
Location 10:66109565-66109587
Sequence CTTACTCCTGCTACCTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069238593 Original CRISPR CTTACTCCTGCTACCTATGT TGG (reversed) Intronic
902090075 1:13896108-13896130 CTGCCTCCTGCTACCTATGCTGG + Intergenic
907058282 1:51393105-51393127 CTCACTCTTGCTACTCATGTTGG + Intronic
908013782 1:59810979-59811001 CTTAGGCCTGCAATCTATGTGGG + Intergenic
908641366 1:66227712-66227734 CTTAGAAATGCTACCTATGTTGG - Intronic
911488014 1:98526612-98526634 CTTAATCCTGTTATCTTTGTAGG - Intergenic
911758480 1:101588665-101588687 CTCATTTCTGCTACCTTTGTGGG + Intergenic
915415479 1:155739092-155739114 GTTATTCCTCATACCTATGTGGG - Intergenic
916325084 1:163547736-163547758 TTTTCTCCTGCGATCTATGTTGG + Intergenic
916478493 1:165193176-165193198 CTTACTCCTTCTAACTAACTGGG - Intergenic
924700650 1:246448776-246448798 TTTGCTCCTGCTTCCAATGTAGG + Intronic
1064249208 10:13693935-13693957 CTTCCCCTTGCTACCCATGTTGG + Exonic
1064359401 10:14650050-14650072 CTTCCTCCTTCTTCCTATCTGGG - Intronic
1067800608 10:49356051-49356073 CTTACACCTGCTACATATTTTGG + Intergenic
1068456540 10:57261715-57261737 CTTGCTGCTGCTCCCTATTTGGG + Intergenic
1069231577 10:66015605-66015627 CTTAATTCTGCTATTTATGTAGG - Intronic
1069238593 10:66109565-66109587 CTTACTCCTGCTACCTATGTTGG - Intronic
1070390697 10:75967959-75967981 CTGCCTCCTGCTAACTCTGTGGG + Intronic
1071278717 10:84079895-84079917 CCTGCTACTGCTTCCTATGTAGG - Intergenic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1075969446 10:126640087-126640109 TTTACTCCTGCTTCCTGTGGAGG - Intronic
1078137543 11:8664024-8664046 CTGACTCCTGCTATCTAACTTGG - Intronic
1078624521 11:12941813-12941835 CTTACTACTGTTACTTTTGTAGG + Intronic
1079161135 11:17995274-17995296 CTCACTCCTGCTTCCTTTTTGGG + Intronic
1080403291 11:31956502-31956524 CTTACACATGCTATGTATGTGGG + Intronic
1083683829 11:64364249-64364271 CTTCCTCCTGCTCCCTACCTGGG - Intronic
1086399383 11:86448136-86448158 CTCCCTCCTCCTACCTATGATGG + Exonic
1093817010 12:23561240-23561262 CTCACTCCTGCAACCCAAGTAGG + Intronic
1096219865 12:49822336-49822358 ATTTCTCCTGCCGCCTATGTCGG - Intronic
1100543913 12:95583683-95583705 TTTGCTCCTGCTGCCCATGTTGG + Intergenic
1101123840 12:101610818-101610840 CCTTTCCCTGCTACCTATGTTGG - Intronic
1107660097 13:42630397-42630419 GTTGCTCCTGCTATCTATTTAGG + Intergenic
1114639498 14:24209839-24209861 CTTCCTAATGCTACCTTTGTTGG - Exonic
1124531556 15:30512471-30512493 CCTATTCCTGCTGCCTATGGTGG - Intergenic
1124767102 15:32495224-32495246 CCTATTCCTGCTGCCTATGGTGG + Intergenic
1125224336 15:37378380-37378402 CTTACTCCTCCCAGCTTTGTAGG - Intergenic
1131511821 15:93053388-93053410 CTTTCTCCTGGAACCCATGTAGG - Intronic
1135767364 16:25189248-25189270 CTCACTCCTGTCACCCATGTTGG + Intergenic
1137410102 16:48221127-48221149 CTTCCTCCTGCCACCTAGGCTGG - Intronic
1139233392 16:65308911-65308933 CTTACTCCTGCTTCATGTGTAGG + Intergenic
1145886616 17:28386277-28386299 CTCACTCCTGCTGCCTAGGCTGG - Intronic
1145900785 17:28489300-28489322 CTTAATCCTGTTCCCTATGATGG + Exonic
1147021442 17:37537148-37537170 CTTACTCCTGCCACCTCACTTGG - Intronic
1149332219 17:55595992-55596014 CTTACTCCTGCTGCCCAGGCTGG + Intergenic
1150242189 17:63643479-63643501 CTTACTCCTGCCACCCAAGCTGG - Intronic
1152443915 17:80329189-80329211 CTCACTCCTGCTTCCTCTGTTGG + Intronic
925564216 2:5232249-5232271 CTAAATCCTAATACCTATGTGGG - Intergenic
933470032 2:82710456-82710478 TTTACTCCTGCTTCTGATGTGGG + Intergenic
936764218 2:115826126-115826148 CTTACTCCTGCTTTCTAGGAAGG + Intronic
938049499 2:128155097-128155119 TTTACCCCTGCTTCCTCTGTAGG + Intronic
939874144 2:147557078-147557100 CTTACAACTGGTTCCTATGTTGG + Intergenic
942094516 2:172524540-172524562 GTTCCTCCTCCTACCTATGGCGG - Intergenic
942314327 2:174683441-174683463 CTGACTCCTGCCCACTATGTGGG + Intergenic
942788519 2:179731331-179731353 CTGACTCTTGCTATCTGTGTGGG - Intronic
946908418 2:224437765-224437787 CCCTCTCCTGCTACCTATGAAGG + Intergenic
1172333596 20:34094915-34094937 CATACTCCCGCTAGCAATGTAGG - Intronic
1175983494 20:62752994-62753016 CTTGCTCGTGCCACCTGTGTGGG - Intronic
1177420930 21:20855627-20855649 CTTACTTCTGGTACTTTTGTGGG - Intergenic
1185303813 22:50100919-50100941 TCTACTCCTGCTGCCTATGGTGG + Intronic
949213574 3:1536648-1536670 CTTAATCCTGTTATCTTTGTAGG + Intergenic
950251281 3:11467690-11467712 CTTTGTCCTGTTTCCTATGTGGG + Intronic
956071712 3:65459893-65459915 CTCACTCCTGTTGCCCATGTTGG - Intronic
956740400 3:72271261-72271283 CTAACCCCAGCCACCTATGTTGG + Intergenic
960008221 3:112803956-112803978 CTTACTCCTATTACCTTTTTTGG - Intronic
962627697 3:137242997-137243019 CTTATTCCTGCTTTCTTTGTAGG + Intergenic
967156705 3:186698972-186698994 CTTATTCCTGCTCCCTCTGTCGG - Intergenic
974311349 4:60214334-60214356 CTTCCTCTTACTAGCTATGTGGG - Intergenic
977078698 4:92493339-92493361 CTTCCACCTGATACCTATGCTGG + Intronic
979189972 4:117844739-117844761 CTTACTACTGCTACATAGGCAGG - Intergenic
989264789 5:39460634-39460656 CTTAACCCTTCTAACTATGTGGG - Intronic
995391290 5:111642597-111642619 ATTGCTCCTGTTACATATGTTGG + Intergenic
998235352 5:140393823-140393845 CTTGCTCCTGTTACCTAGGTTGG - Intergenic
998415737 5:141945032-141945054 CTGACTCCTGCTACCCAAGAAGG + Exonic
1003453512 6:6260052-6260074 CTCACTCCTGCTGCCTTTGTGGG + Intronic
1005203066 6:23369154-23369176 CTCACTCCTGCCACCTATCCCGG + Intergenic
1010177215 6:73043106-73043128 CTTACTCCTGTTCCCTATGGTGG + Intronic
1010965641 6:82204264-82204286 CTTATTCCTTTTAACTATGTTGG - Intronic
1016660666 6:146575488-146575510 CTCACTCCTGTTGCCTAAGTGGG + Intergenic
1017774939 6:157673158-157673180 CTCACTCCTGCTGCCCATGGAGG - Exonic
1017829524 6:158113477-158113499 CTTAATCATGCTGCCAATGTAGG + Exonic
1018966616 6:168495146-168495168 CATGCTCCTGCGCCCTATGTGGG + Intronic
1028116666 7:87004897-87004919 CTTCCTACTGCTTACTATGTAGG - Intronic
1028853689 7:95565931-95565953 CTTATTCCTGTTACTTATTTAGG + Intergenic
1036362735 8:8090617-8090639 CTTACTCATGCTACATCTGCAGG - Intergenic
1036546574 8:9776204-9776226 CTTACTCCTTCTAGCTCAGTGGG + Intronic
1036895821 8:12634554-12634576 CTTACTCATGCTACATCTGCAGG + Intergenic
1037490358 8:19391653-19391675 CCTTCTCCTGCTTCCTATTTAGG - Intronic
1040813728 8:51484476-51484498 GTTACTCATGCTACATCTGTAGG - Intronic
1040907105 8:52480300-52480322 CTTCCTCCTGCTGCGTCTGTTGG - Intergenic
1045552098 8:103181807-103181829 TTTTCACCTGCTACCTAAGTGGG - Intronic
1048347920 8:133591913-133591935 CTTTCTCCAGTTACCTCTGTGGG + Intergenic
1048660609 8:136596315-136596337 CCTACTCCTGCTACAGATGAGGG - Intergenic
1051443106 9:17108617-17108639 CTTTGTCTTGCTACCTTTGTAGG + Intergenic
1060436035 9:123593961-123593983 CTTTCTCCTGCTGGCCATGTGGG + Intronic
1060865027 9:126988817-126988839 CTTCCTGCTGCTCCCTAAGTGGG - Intronic
1186432749 X:9518890-9518912 CTTACACCTCCTACCCATGTAGG + Intronic
1192582441 X:72295868-72295890 TTTGTTCCTGCTACCTATGCAGG + Intronic
1197833171 X:130667029-130667051 CTTTCTTCTGCTACCTTTGCTGG - Intronic
1200315536 X:155128438-155128460 CTTCCTCTTGCTGTCTATGTAGG + Intronic