ID: 1069248910

View in Genome Browser
Species Human (GRCh38)
Location 10:66244483-66244505
Sequence TCCAGTGATGTGGCCACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069248904_1069248910 15 Left 1069248904 10:66244445-66244467 CCAGTGCTGTGCTGATTTCAGGT 0: 1
1: 39
2: 222
3: 476
4: 671
Right 1069248910 10:66244483-66244505 TCCAGTGATGTGGCCACAGTGGG No data
1069248902_1069248910 16 Left 1069248902 10:66244444-66244466 CCCAGTGCTGTGCTGATTTCAGG 0: 1
1: 35
2: 225
3: 463
4: 1184
Right 1069248910 10:66244483-66244505 TCCAGTGATGTGGCCACAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069248910 Original CRISPR TCCAGTGATGTGGCCACAGT GGG Intronic
No off target data available for this crispr