ID: 1069251126

View in Genome Browser
Species Human (GRCh38)
Location 10:66268474-66268496
Sequence AAGGAGTAGAAGACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 549}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069251126_1069251130 6 Left 1069251126 10:66268474-66268496 CCTTCCTCAGTCTTCTACTCCTT 0: 1
1: 0
2: 2
3: 52
4: 549
Right 1069251130 10:66268503-66268525 GATGTCAGACATGCACAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069251126 Original CRISPR AAGGAGTAGAAGACTGAGGA AGG (reversed) Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
902951351 1:19885353-19885375 AAGGACTAGGATACTGACGAGGG - Intronic
903162298 1:21497838-21497860 GAGGAGTTGAAATCTGAGGAGGG + Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906708081 1:47909540-47909562 AAGGAGGAGAAGAAGGAAGAAGG + Intronic
907594058 1:55703641-55703663 GAGGAGTGGAAGAGAGAGGAAGG + Intergenic
907786507 1:57618122-57618144 AAGGAGAAGAAGACTGGGCGCGG + Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
911420272 1:97632361-97632383 AAGCAGTAGAATACTGGGGATGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911576995 1:99589752-99589774 AATGAGTAGAGCACTCAGGAAGG + Intergenic
911701345 1:100956401-100956423 AGGGAGTAGCAGACTTTGGAAGG + Intronic
912039672 1:105372730-105372752 AAGGAGGAGAAGAAATAGGAAGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912228636 1:107766238-107766260 AAGAAGAAGAAGAAGGAGGAGGG - Intronic
912406260 1:109440598-109440620 AATTAGTAGAAGTCTGGGGATGG - Intergenic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913244647 1:116860898-116860920 AAAGACTAGAAGACTGAGGGAGG + Intergenic
913705174 1:121413843-121413865 AAGGAGAAGAGGACTGTAGAAGG + Intergenic
915137050 1:153739904-153739926 CAGGAGGAGGAGACTGAGGCAGG - Intronic
915393170 1:155562512-155562534 AAGGAGTGGAAGGTTGAGGGGGG - Exonic
915646090 1:157273715-157273737 AAGGAGTTGCAGAGTGGGGATGG + Intergenic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
916059028 1:161086422-161086444 CAGGAGTAGAAAAGTAAGGATGG + Intronic
916181633 1:162088973-162088995 AAGGAGTGGAAGAGAGATGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916635425 1:166662749-166662771 ATGGAGTAGAAGATGGAAGAAGG - Intergenic
917470782 1:175324173-175324195 ACAGAGTAGAAGCCAGAGGAAGG - Intronic
917477034 1:175377898-175377920 AAAGAGTAGAAGACTGGAAATGG - Intronic
917725820 1:177826209-177826231 AAGGAGAAGAAACCTGAAGATGG - Intergenic
918748212 1:188234175-188234197 AAGGAGTAGGAGAATAAAGACGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919324773 1:196092867-196092889 AAACAGTAGAATATTGAGGAAGG - Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
921353035 1:214256939-214256961 ATGGAGTGGAGGACTGAGAAGGG + Intergenic
921902066 1:220461904-220461926 AAGCAGTTGGAGACTGAGGTGGG + Intergenic
922595697 1:226811073-226811095 AAGGAGGAGAAGAGAGAGGTGGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923072437 1:230577889-230577911 AAGGAGAAGAAGAAGGAGAAGGG - Intergenic
923152354 1:231244811-231244833 AATGAAAAGAAGACTGAGGATGG + Intronic
923385856 1:233464672-233464694 AAGTAATAGAAGCCTGAAGAAGG - Intergenic
923743804 1:236682349-236682371 ACTGAGTAGAATACTTAGGAAGG - Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924604834 1:245524179-245524201 AAGGAGTAAAAGATAGGGGAAGG + Intronic
1063578868 10:7287395-7287417 AAGAAGTATCAGACTGTGGAGGG + Intronic
1064003528 10:11682675-11682697 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1064212219 10:13369651-13369673 AAGGAGTAGAAGGCCGGGCATGG + Intergenic
1064855127 10:19758984-19759006 AAGAAGAAGAAGACAGAGAATGG - Intronic
1065129395 10:22605115-22605137 AAGAAATATACGACTGAGGAGGG + Intronic
1065227680 10:23562074-23562096 ATGGATTAGAAGACTCAGTATGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067973469 10:50996923-50996945 AAGGGGAGGAAGGCTGAGGAAGG + Intronic
1068766094 10:60765422-60765444 AAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1068833949 10:61531364-61531386 AGGGAGTAGGAGAGTGGGGATGG + Intergenic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1069500529 10:68949098-68949120 TAAGAGCAGAGGACTGAGGAGGG + Intergenic
1069588872 10:69630023-69630045 AAGAAGGAGAAGAAGGAGGAGGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070809455 10:79290336-79290358 GAGGAGTGGAAGAGAGAGGAAGG - Intronic
1070906334 10:80076759-80076781 AAGGAGGAGAAGAATAAAGAGGG + Intergenic
1071146449 10:82579412-82579434 AAGGAATTGAAGGCTGTGGAGGG - Intronic
1072090823 10:92125544-92125566 AAGGGGTAGAAGGCTCAGGGTGG + Intronic
1072456909 10:95584460-95584482 AAGGAGTAGAACAAGGAGTATGG - Intergenic
1073515409 10:104071388-104071410 AAGGAGTAGAAGAAAGAACATGG - Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1077968811 11:7165915-7165937 AAGGAGTAAAACACTGGGAAAGG + Intergenic
1078149790 11:8748661-8748683 AAGGAAGAGAAGACTTAGAAGGG + Intronic
1078807891 11:14725047-14725069 AAGGATTATGTGACTGAGGAAGG + Intronic
1079360321 11:19765464-19765486 AAGGAGAAGGAGACAGAGGGAGG - Intronic
1079461687 11:20685804-20685826 AAAAAGCAGAAGACTGGGGAAGG + Intronic
1079826060 11:25195021-25195043 AAGAAGTAGATGGCAGAGGAAGG - Intergenic
1079959083 11:26900506-26900528 AAGAAGTAGAAGAAAGAGGTAGG - Intergenic
1081533802 11:43983012-43983034 AAGGGGTGCAAGACAGAGGAGGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082921979 11:58505409-58505431 AAGGAGGAGCAGGATGAGGAGGG + Intergenic
1083228669 11:61300974-61300996 AAGGTGGGGATGACTGAGGAGGG - Intronic
1083434120 11:62630994-62631016 AAAGAGCAGAAGAATGAGGCAGG + Intronic
1083463877 11:62832680-62832702 AAGGAGGAAGAGTCTGAGGACGG - Intronic
1083546725 11:63554302-63554324 CCAGAGGAGAAGACTGAGGATGG + Intronic
1083830875 11:65232826-65232848 AAAGAGAAGAAGATGGAGGAAGG - Intergenic
1084135446 11:67176273-67176295 AGGGAGTAGAAGTCTGTGAAAGG - Intronic
1085033038 11:73284116-73284138 AAGGCTTAGAAGACAGAGGAGGG + Intronic
1085150247 11:74246672-74246694 AAGGCATAGATGAATGAGGAAGG - Intronic
1085413623 11:76306279-76306301 AAGGTGAGGAAGACAGAGGAGGG - Intergenic
1085810888 11:79680071-79680093 AAGGAGGAGAAGAAAGAGAAAGG - Intergenic
1086316665 11:85602103-85602125 GAGGAGAAGCAGACTGAGGGTGG - Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1087043061 11:93820401-93820423 ATGGAGTTGAGGACTGTGGATGG - Exonic
1087352418 11:97048919-97048941 AAGGCTTGGAAGACTGATGAAGG - Intergenic
1087491077 11:98828003-98828025 CAGGATTAGGAGACTGAGCATGG - Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1087796696 11:102461609-102461631 AAGGAATAGAAGCCAAAGGAAGG + Intronic
1087859312 11:103134013-103134035 AACAAGGAAAAGACTGAGGAGGG - Intronic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1089386322 11:118070580-118070602 AAGGGTTAGAAGACACAGGAAGG - Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1091456887 12:614545-614567 AAGGGGAAGAAGACAGAGGGAGG - Intronic
1091667981 12:2432901-2432923 AAGGAATTGGAGACTGAAGAGGG + Intronic
1091756993 12:3060084-3060106 AAGGAGTATAAAAGTGAAGATGG - Intergenic
1092333902 12:7611262-7611284 ACTGAGTAGGAGACTGAGGCAGG + Intergenic
1093078325 12:14780292-14780314 AAGGAATAGAAGACTAAAAATGG + Intergenic
1093573360 12:20695313-20695335 AAGGAACAGAAGCCAGAGGAGGG - Intergenic
1093832223 12:23776382-23776404 AAGAAGGATATGACTGAGGAAGG + Intronic
1094020100 12:25904834-25904856 AAGGAGTGGAGGAATCAGGAAGG - Intergenic
1094126205 12:27024504-27024526 AAGGAGTAGTTCCCTGAGGAAGG - Intronic
1094227819 12:28066142-28066164 CAAGAATAGAACACTGAGGAAGG + Intergenic
1094232411 12:28122324-28122346 AAGAAGCAGAAGAATGAGGAGGG + Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095624695 12:44301174-44301196 ACAGAGTAGAAGCATGAGGATGG - Intronic
1095954547 12:47798685-47798707 AAGGAGTTGAGGACTGAGACTGG + Intronic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096608919 12:52788388-52788410 AAGGAGTAGGAGACACAGGTGGG - Intergenic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1098486850 12:71031491-71031513 GAAGAGGAGAAGATTGAGGAGGG + Intergenic
1098495878 12:71135279-71135301 AAGAAGAAGAAGAAGGAGGAGGG + Intronic
1098588223 12:72181061-72181083 AGGTAGAAGAAGACTGAGAATGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099403216 12:82225799-82225821 AAGGAGAAGTAGGTTGAGGATGG - Intronic
1100105503 12:91166791-91166813 AAGAATTAGAATCCTGAGGATGG - Intronic
1100123653 12:91397336-91397358 GAGGAGTAAAAGGCTCAGGAGGG - Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1101057644 12:100935543-100935565 TAGGAGAAGAAGTCTAAGGAAGG + Intronic
1101376078 12:104172482-104172504 ATGGAGTGGAAGAGTAAGGAAGG + Intergenic
1102974978 12:117200190-117200212 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103590578 12:121989563-121989585 AGGGAGTAGTGGGCTGAGGAGGG - Intronic
1103619880 12:122180795-122180817 AAGGAAGAGAAGACTGAGAGGGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1105775320 13:23654239-23654261 TAGCAGTAGAAGGCAGAGGAGGG + Intronic
1106565630 13:30882074-30882096 CAGAAGTAAAAGGCTGAGGAAGG + Intergenic
1107349486 13:39499403-39499425 AGGGAGGAGAGGACTGAGGAAGG - Intronic
1108177460 13:47807871-47807893 AAGGAGATGAAAACTGATGAAGG + Intergenic
1108730139 13:53226584-53226606 TAGGTGTAGAAGAGAGAGGAAGG - Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109004116 13:56847139-56847161 AAAGACTAGAAGGCGGAGGAAGG - Intergenic
1109651577 13:65334327-65334349 AAGGAGTAGAACAATTATGATGG + Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110977392 13:81856578-81856600 ACAGAGTAGAAATCTGAGGATGG + Intergenic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1111252142 13:85615595-85615617 AGGGGGTAGAGGACTGGGGAGGG - Intergenic
1111276200 13:85950632-85950654 AAGGAGGAGAAGAATGAAGCTGG - Intergenic
1111676146 13:91391142-91391164 AGCTAGGAGAAGACTGAGGACGG + Intergenic
1111680978 13:91440986-91441008 AAGAACTAGAAGACAGAGGTTGG - Intronic
1111695133 13:91613916-91613938 AAGTAGATGAAGACTGAGAAAGG + Intronic
1112155299 13:96810319-96810341 AAGGGGTAGAAGAGAGAAGAAGG + Intronic
1112304040 13:98257474-98257496 AAGAAGTAGAACCCTGAGGCTGG + Intronic
1112708131 13:102095625-102095647 AAGGGGGAGGAGAATGAGGAGGG - Intronic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1113540019 13:111100022-111100044 TAGGAACAGAAGAATGAGGAAGG + Intergenic
1113626602 13:111852510-111852532 ATGGACTAGGGGACTGAGGAAGG + Intergenic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1114824813 14:26064160-26064182 CAGGAGCAGAAGTCTGAAGATGG + Intergenic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1117242885 14:53853093-53853115 AAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1117394430 14:55294799-55294821 AACCACTAGAAGACTGAGGCAGG - Intronic
1117931471 14:60846147-60846169 AAGGAATAGGAGAATGGGGAAGG - Intronic
1118890830 14:69907437-69907459 AATGGGTAGAAGACTCAGAAAGG - Intronic
1119110533 14:71969614-71969636 AAGGAGGAAAAGAATGAAGAAGG - Intronic
1119874072 14:78042176-78042198 AGTGAGTAGAAGAGTGGGGAAGG + Intergenic
1120366737 14:83580956-83580978 AAGGGCTAGAAAAATGAGGAAGG - Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1121764067 14:96470247-96470269 AAGGCGGAGAAGGATGAGGAGGG + Intronic
1122579390 14:102762146-102762168 AAGGACTAGGAGAGTGGGGAGGG + Intergenic
1124075042 15:26436486-26436508 AAGGGGCAGAAGACAGACGATGG + Intergenic
1124363814 15:29057343-29057365 AATGAGTAGAAGAGAGGGGAGGG - Intronic
1124562395 15:30787185-30787207 AAGGAGTATAAGACTGTGAATGG + Intergenic
1124602416 15:31146084-31146106 AAGGAGTTTAATACTGAGTATGG - Intronic
1124956547 15:34364096-34364118 GAGGTGAAGAAGACTGAAGAAGG + Intronic
1125612590 15:40981934-40981956 AGGGAGGAGAAGAATGAGGAAGG - Intronic
1125891958 15:43273705-43273727 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1125974181 15:43936554-43936576 TAGGAGTTGAAGACTCAGGAAGG - Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1126117434 15:45221427-45221449 AAAGAGTAGAGGACAGAGAAGGG + Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1127107862 15:55636440-55636462 AAGGGAGAGAAGATTGAGGAAGG - Intronic
1127117016 15:55738874-55738896 CAGGAGGAAAAGACAGAGGAAGG + Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127320600 15:57841408-57841430 GAGAAGGAGAAGACTGAGGCTGG + Intergenic
1127821986 15:62666380-62666402 AAGGAGCAGAAGACCAAGCAAGG - Intronic
1128095748 15:64953691-64953713 AAGGAGAAGAAGAAAGAAGAAGG - Intronic
1128157200 15:65399100-65399122 AAGATGTAGAGGACTGAGGCAGG + Intronic
1128207395 15:65865458-65865480 AAGAAATAGAACACTGAGGCCGG + Intronic
1128228146 15:66017122-66017144 AAGCAGTAGGGGACGGAGGAGGG + Intronic
1128997416 15:72307047-72307069 AAAGAGTAGAAGCCTGGGGTGGG + Intronic
1129275609 15:74443288-74443310 TGGGAGTAGAAGACTGAGGGAGG - Intergenic
1129837218 15:78717193-78717215 AAGGAGAATAAGACTGTGAATGG + Intronic
1130095416 15:80851916-80851938 AAGGAGGAGGAGACTGGAGATGG + Intronic
1130128714 15:81117841-81117863 AAGGACTAGGAGAATGAGGATGG - Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130266733 15:82412120-82412142 AAGGAGTGGGAGACTTAGCAGGG + Intergenic
1130267948 15:82425939-82425961 AAGGAGAATAAGACTGTGAATGG + Intergenic
1130504076 15:84520895-84520917 AAGGAGAATAAGACTGTGAATGG - Intergenic
1130505288 15:84534760-84534782 AAGGAGTGGGAGACTTAGCAGGG - Intergenic
1130750002 15:86701701-86701723 AGGGAGTGGAAGGCAGAGGAAGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131430162 15:92380888-92380910 AAGGAGGAGAAGGAGGAGGAGGG + Intergenic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1132183959 15:99787482-99787504 AAGGAGAATAAGACTGTGAATGG + Intergenic
1132434421 15:101785663-101785685 AAGGAGAATAAGACTGTGAATGG - Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1134024049 16:10941463-10941485 ACGGAGGAGAAGCCTGAGGGAGG + Intronic
1134148398 16:11786015-11786037 CAGTAGTAGAAGACTGAGGCTGG + Intronic
1135913147 16:26579214-26579236 AAGGAGGAGAAGAAGAAGGAAGG - Intergenic
1135937521 16:26793668-26793690 AAGGAGCAGAAGAGGGAGGGAGG - Intergenic
1136037429 16:27550450-27550472 GAGAAGTAGAGGTCTGAGGAGGG + Intronic
1136227092 16:28866494-28866516 GAGGAGGAAGAGACTGAGGAAGG - Exonic
1136539095 16:30918701-30918723 AAGGAGGAGAAGGAGGAGGAAGG - Intergenic
1137294424 16:47076724-47076746 AAGGAGTAGAACATGGGGGAAGG - Intergenic
1137386497 16:48047474-48047496 AAGGAGGAGAAGCAGGAGGAGGG + Intergenic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1138191009 16:55014192-55014214 AAGGAGTAGAAGATTGGGCTGGG + Intergenic
1138541602 16:57691055-57691077 AAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1138775360 16:59716355-59716377 AATGAGTAGAAAGATGAGGATGG + Intronic
1138912733 16:61421861-61421883 AAGGATGAAAAGAATGAGGATGG + Intergenic
1138972811 16:62167308-62167330 AAGGAGAAGAAGACAAAGAAGGG - Intergenic
1139267606 16:65654923-65654945 AAGGACCAGAAGAGAGAGGAGGG + Intergenic
1139532968 16:67552483-67552505 ATGGAACAGAAGCCTGAGGAGGG + Intergenic
1140357050 16:74315383-74315405 ATGGAGTAGAATAGGGAGGAGGG - Intergenic
1141001565 16:80313072-80313094 AAGAAGTAGAAGAATGAGATGGG + Intergenic
1141452977 16:84117863-84117885 ACGAAGTAGAAGCCTGAGGTGGG - Intergenic
1143341342 17:6213750-6213772 AAGCAGAAGAAGACTGGGCACGG - Intergenic
1143410849 17:6707504-6707526 AAGGAGGAGAAGGAGGAGGAGGG + Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1146496572 17:33327964-33327986 AAGCCAAAGAAGACTGAGGATGG + Intronic
1146915170 17:36673724-36673746 GAAGAGAAGAAGACAGAGGAGGG + Intergenic
1147785649 17:42976762-42976784 AAGGAGGAGACGACTTTGGAGGG + Intronic
1148357563 17:46985848-46985870 GAGCAGAAGAAGACAGAGGAGGG - Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148891883 17:50813560-50813582 AGGTAGTAGAAGAATTAGGAAGG + Intergenic
1149114164 17:53071726-53071748 AAGGAGAAGAAGAAAAAGGAGGG + Intergenic
1149128810 17:53270258-53270280 AAGAAGTAGAACACATAGGAAGG + Intergenic
1150423612 17:65058952-65058974 AAGAAGAAGAAGAAGGAGGAAGG + Intergenic
1153326618 18:3827040-3827062 AAGAAGGAGTAGACTCAGGATGG + Intronic
1153723520 18:7932138-7932160 AAAGAGCAGAAGACGGAGGTGGG + Intronic
1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG + Intergenic
1156078182 18:33305742-33305764 AAGGAGGAGAAGAAGGAGGAGGG - Intronic
1156203117 18:34856556-34856578 AAGTACCAGAAGACTGAGGCAGG + Intronic
1156390420 18:36645084-36645106 GAGGAAAAGAAGACTGAGGCTGG + Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1157500334 18:48186065-48186087 AAGGTGCAGAAGCCTGAGGTCGG - Intronic
1158217774 18:55117724-55117746 AAAAAGTAGAAGAAGGAGGAGGG + Intergenic
1159247335 18:65824739-65824761 ATGGAGTACAAGATTGTGGATGG + Exonic
1159300992 18:66567341-66567363 AAGGAGTAGAAGGTGGAGAAGGG + Intronic
1159725071 18:71947056-71947078 AAGGAATAGAAGATGGAGGGAGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160969507 19:1761341-1761363 AAGGAGGAGAAGGCTGGGCACGG - Intronic
1161370539 19:3908653-3908675 AAGGAGGAGAAGAAAGGGGAAGG - Intronic
1161370603 19:3908843-3908865 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1161564030 19:4989629-4989651 AAGAAGAAGAAGACTGGGCATGG - Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163188824 19:15660441-15660463 AAGAAGTAGACCACTGAGAAGGG + Exonic
1163665664 19:18603005-18603027 AAGAAGTAAAACACTGAGGCCGG - Intronic
1163779166 19:19237197-19237219 AAGGAAAAGTAGGCTGAGGATGG - Intronic
1165482674 19:36074006-36074028 AAGGAGTTGAAGACGGGGCATGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166332954 19:42089241-42089263 AAGGAGGAGAGGAGAGAGGAAGG + Intronic
1168233464 19:55047499-55047521 AAGAAAGAGAAGACTGAGGGAGG + Intronic
925640609 2:5982885-5982907 AAGGAACAGAAGACGGAGGCAGG - Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
928099371 2:28426898-28426920 AAGGAATAGGAGGCTGAGTATGG + Intergenic
928180324 2:29064115-29064137 AAGGAGGAGAGGACAGAGGACGG + Exonic
930029494 2:47049494-47049516 AAGGAATGGAAGCCTGAGGCAGG + Intronic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
931052869 2:58433226-58433248 AAAGAGGTGAAGACTGAGTATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932124112 2:69127852-69127874 AGGGAGAAGAAGACTTAGGGAGG + Intronic
932743876 2:74314992-74315014 AAGGAGGAGAAGGCTGGGGTAGG - Exonic
933699350 2:85243612-85243634 CAGGAGGAGAAGGCTGGGGATGG + Intronic
934128044 2:88917526-88917548 AAAGAGTAGAAGACAGAGGATGG - Intergenic
934155460 2:89195839-89195861 AAGCAGTAGGAGAATGGGGAAGG - Intergenic
934211863 2:89986919-89986941 AAGCAGTAGGAGAATGGGGAAGG + Intergenic
934773155 2:96920874-96920896 GAGGAGCTGAAGACTGGGGAGGG + Intronic
935662485 2:105479142-105479164 ATGGAGTTTAAGACTTAGGAAGG + Intergenic
936882408 2:117269886-117269908 CAGGAGTAGAAGACAGGGGCTGG - Intergenic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937718012 2:125057156-125057178 GAGAAGTAGAATCCTGAGGATGG - Intergenic
937909740 2:127069678-127069700 AAGGTGTAGAAGGGTGAGTAGGG - Intronic
939411627 2:141834088-141834110 AGGGAGTTCAAAACTGAGGATGG + Intronic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
940092845 2:149940818-149940840 AAGGAAGAGAAGAAAGAGGAAGG - Intergenic
940844053 2:158620660-158620682 AGGGATTAAAAGACTGAGAATGG - Intronic
941891384 2:170585507-170585529 AAGGTGTAAAAAATTGAGGATGG - Intronic
943060950 2:183040775-183040797 AAGGAGGAGGAGAGGGAGGAGGG + Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
944385510 2:199159618-199159640 ATAGAGTATAAGACTGTGGATGG - Intergenic
945202765 2:207300066-207300088 GACGAGTAGAAGAATGAAGAAGG + Intergenic
945520819 2:210824945-210824967 CAGGAGTAGAAGACCTAGGAAGG - Intergenic
945705146 2:213221367-213221389 AAGCAGTAGAACAGAGAGGAAGG + Intergenic
946368367 2:219265105-219265127 AAGGAGATAAAGACCGAGGAGGG + Intronic
946528533 2:220546585-220546607 AAGGAGAAGAAGAAAGAAGAAGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
948230997 2:236349220-236349242 ATGGAGCTGAAGAGTGAGGAGGG + Intronic
948274699 2:236699446-236699468 AAGGCTTAGAGGACTGAGGATGG - Intergenic
948428530 2:237903482-237903504 AAGGTGTAGGATACTGAGGCAGG - Intronic
948538992 2:238672320-238672342 AAGGAGGAGAAGAAGGAGAAGGG - Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168746074 20:242104-242126 AAGGAGGAGGAAACAGAGGAGGG + Intergenic
1170081878 20:12485508-12485530 AGGGAGTGGAAGACAGAGAAGGG - Intergenic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1170907537 20:20529246-20529268 AAAGAGAAGAGGACTGAGGAAGG - Intronic
1170998539 20:21390999-21391021 AAAGAGATGAAGACTAAGGATGG - Intergenic
1171278771 20:23879722-23879744 AAGCAGCAGAAGGCTGAGGCAGG + Exonic
1172437924 20:34943067-34943089 CAGGAGTCAATGACTGAGGATGG - Intronic
1173997428 20:47349165-47349187 TAGGAGGAGAGGACTTAGGATGG + Intronic
1174897236 20:54462622-54462644 AAGTAGGAGTAGACTGGGGAAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175387464 20:58606350-58606372 AAGGAGCAGAAGACGGAGCATGG + Intergenic
1175555730 20:59854684-59854706 AGAGATTAGAAGAGTGAGGAGGG + Intergenic
1176345460 21:5740875-5740897 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176352274 21:5861459-5861481 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176499367 21:7583580-7583602 AAGTAGTAGAAGGTTGAGGGCGG + Intergenic
1176539781 21:8138945-8138967 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176558732 21:8321990-8322012 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1176843278 21:13857464-13857486 AGGGAGTAGCAGACAGAGGTCGG - Intergenic
1177553964 21:22665877-22665899 AGGGAGTAGATGACTCAGAAAGG + Intergenic
1178165306 21:29967939-29967961 AAGAATAAGAAGACTGAGAACGG - Intergenic
1178286260 21:31327971-31327993 AAGGAGATGAAGACAGAGGAGGG - Intronic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181911783 22:26244185-26244207 AAAGAGTAGAAAAATGAGCAGGG + Intronic
1181977211 22:26738473-26738495 AAGGAGGAGAACAAGGAGGAGGG - Intergenic
1182099525 22:27648162-27648184 AAGAAGGAGAAGAAGGAGGAGGG + Intergenic
1182126069 22:27816756-27816778 AAGGATCAGAAGAGGGAGGAGGG - Intergenic
1182679282 22:32066139-32066161 AAGGAGAATAAGACTGTGAATGG - Intronic
1182863633 22:33583104-33583126 AAGATGGAGAAAACTGAGGAAGG - Intronic
1183093357 22:35538587-35538609 CAGGAGCAGAAGACAGAGGCTGG + Intergenic
1183354538 22:37351143-37351165 AAGGAGGAGAGGAGGGAGGAGGG - Intergenic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
1184782794 22:46657509-46657531 AGAGACTGGAAGACTGAGGATGG - Intronic
1203244734 22_KI270733v1_random:55300-55322 AAGTAGTAGAAGGTTGAGGGTGG - Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949148072 3:728039-728061 AAGGAACAAAAGACAGAGGATGG + Intergenic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950553101 3:13679449-13679471 AGGCTTTAGAAGACTGAGGAAGG - Intergenic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
950733651 3:14986477-14986499 AAGAAGGAGAAAATTGAGGAAGG + Intronic
950964808 3:17138785-17138807 GAGGAGGAGAAGACAGAGCAGGG + Intergenic
951813379 3:26726509-26726531 AAGGAGTAGAGAGCTGAGGAGGG - Intergenic
953169613 3:40495425-40495447 AAGAAGGAGAGGAGTGAGGAGGG - Intergenic
953866295 3:46586012-46586034 AAGGAGGAGAAGGAAGAGGAGGG + Intronic
954361959 3:50126788-50126810 TGGGAGCAGAAGACTGAGGCAGG + Intergenic
954499642 3:50999714-50999736 AAGAAGGAGAAGTCTGAGGTGGG - Intronic
954556228 3:51519697-51519719 TAAGAGTAGAAGCCTGGGGATGG - Intergenic
954862824 3:53704405-53704427 GAGGATCAGAAGACTGAGGGAGG + Intronic
954873237 3:53783897-53783919 AAGAAGCAGGAGACTGAGTAAGG + Intronic
956629194 3:71298168-71298190 AAAGATTAGAAAACTGAGGCCGG + Intronic
957435107 3:80164670-80164692 AAAGAGCAGAAGCCTGAGAAAGG + Intergenic
958842773 3:99228219-99228241 AGGGAGTTGAACACTGTGGAAGG + Intergenic
959123226 3:102257831-102257853 AACGTGCACAAGACTGAGGAAGG - Intronic
959241768 3:103806074-103806096 GAGGATTACAAGACTGAGGAGGG - Intergenic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959768705 3:110066902-110066924 AAGGAGCAGGAGAAAGAGGAAGG - Intergenic
960224747 3:115156641-115156663 AAGAAGTAGAAGAGGCAGGAAGG - Intergenic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
960431879 3:117579553-117579575 AAGGAGAAGAAGAAAGAGGTCGG + Intergenic
960527320 3:118724433-118724455 AAAGAGTAGGAGACTGAGTTTGG + Intergenic
961108857 3:124266543-124266565 GAGGACTAGAATTCTGAGGAAGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
961612502 3:128152457-128152479 AAGGAGCAGGAGAGGGAGGATGG - Intronic
962027768 3:131566715-131566737 TAGGAGTAAAAGGCTGAGAATGG - Intronic
962060961 3:131926906-131926928 AAGGAGTAGGGGTCTGAGGATGG + Intronic
962436144 3:135368571-135368593 AAGGACTTGAAGAGAGAGGAAGG + Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
964305914 3:155339640-155339662 GAGAAATAGAAGACTGTGGATGG - Intergenic
964367332 3:155964197-155964219 AAGGAATGGCAGAGTGAGGAAGG - Intergenic
965276552 3:166690722-166690744 AAGAAGGGGAAGACTGGGGAGGG + Intergenic
965785039 3:172326725-172326747 AACGAGAAAAAGACTGGGGAGGG - Intronic
966027053 3:175296913-175296935 CAGGAGCAGAAGACTCAGAATGG + Intronic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966666135 3:182472993-182473015 TAGAAGAAGAAGACTGAAGAGGG - Intergenic
967319134 3:188178279-188178301 AAAGAGGAGAAGCATGAGGAGGG - Intronic
967399108 3:189040968-189040990 AAAGACCAGAAGACTGTGGAGGG - Intronic
968940012 4:3632867-3632889 CAGGAGTGGAAGACGCAGGAAGG + Intergenic
969540317 4:7784519-7784541 AAGGGAGAGAGGACTGAGGAGGG + Intronic
970101006 4:12522927-12522949 AAGAAGTAGATGACTTACGAAGG + Intergenic
970365212 4:15351262-15351284 GAGGAGGAGAAAACAGAGGAAGG - Intronic
970501222 4:16679294-16679316 AAGGAGGAGGAGAGGGAGGAAGG + Intronic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
973544080 4:51962787-51962809 AAGAAGAAGAAGAATGAGAAAGG - Intergenic
973554540 4:52069293-52069315 AAGTAGTAGAAGTCAGAGGCAGG + Intronic
973565848 4:52186646-52186668 AAGGGGTGCAAGAGTGAGGAAGG - Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
974237746 4:59204260-59204282 AAGCAGTAGAAGATAGATGAAGG - Intergenic
975100673 4:70509397-70509419 AAGGAGAAGAGATCTGAGGAGGG + Intergenic
976235928 4:82896949-82896971 GAGGAGTAGAAGCCTGTGGGAGG - Intronic
977373839 4:96174350-96174372 AGGGAGGAGAAAAATGAGGAGGG - Intergenic
977714082 4:100161428-100161450 ACGGATTAGAAAACTGAGCACGG + Intergenic
978487807 4:109276012-109276034 ATGGAGGAGAAGAGTGAGCAGGG - Intronic
979469293 4:121074820-121074842 CAGGAAGAGAAGACTTAGGATGG + Intergenic
979472539 4:121117655-121117677 AAGGAGCAGAAGGCTGAGGCAGG - Intergenic
981227885 4:142318265-142318287 AAGGAGTGGAAGGCAGAGGAAGG + Intronic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
982469764 4:155774035-155774057 AAGGGGTACAAGACAGAGGAGGG - Intronic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984296407 4:177860383-177860405 GAGGTGTAGAGGAGTGAGGAGGG + Intronic
984330578 4:178310432-178310454 AAGAAGGAGGACACTGAGGAAGG + Intergenic
985212968 4:187614979-187615001 ATGGATTAGAAGACTCAAGATGG + Intergenic
987025949 5:13926445-13926467 AAGGGGTAGAAGACGAAGGTAGG + Intronic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987529773 5:19102470-19102492 AAGAATGAGAAGACTCAGGAAGG - Intergenic
988018304 5:25590027-25590049 AAGGACTATGAGACTGAGGAAGG + Intergenic
988106075 5:26750156-26750178 AAGGAGAAGAAAAAAGAGGAGGG - Intergenic
988211990 5:28215862-28215884 AAGGAGGAGAAGAAGGAGGTGGG - Intergenic
988444590 5:31271417-31271439 ACGCAGTGGAAGGCTGAGGAAGG - Intronic
989234729 5:39133525-39133547 AAGAAGCAGAAGACTAAGAAAGG + Intronic
989756199 5:44958680-44958702 AAGGAGGAGGAGGCAGAGGAGGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991090417 5:62689022-62689044 AGATAGTAGAAGACTGAAGAGGG + Intergenic
991128637 5:63095727-63095749 AATGATTAGAAAAATGAGGATGG - Intergenic
991233535 5:64365548-64365570 AAGTACTAGATCACTGAGGAGGG - Intronic
991460887 5:66857055-66857077 AGGGAACAAAAGACTGAGGAGGG - Intronic
993466176 5:88249770-88249792 AAGGACTGGAAGTCTGAGAAAGG - Intronic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
995372360 5:111433246-111433268 AAGGGCTTGATGACTGAGGAAGG + Intronic
995675913 5:114662239-114662261 AAGGAGTAGAAGCCAGAGGTTGG + Intergenic
996281044 5:121729247-121729269 AAGGAGGAGAAGACAGAAGGAGG - Intergenic
996315724 5:122158621-122158643 AAGATGAAGAAGACTGTGGAAGG + Intronic
996447527 5:123572944-123572966 AAGGTGTATAAGCCAGAGGATGG + Intronic
996489803 5:124080361-124080383 AAGGAGGATATTACTGAGGAAGG - Intergenic
996711469 5:126547506-126547528 AAGCAGTAGAAAACAGAGGCAGG - Intronic
996890115 5:128408814-128408836 AAGGAGAAGATGATTGAGAAAGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997162495 5:131623985-131624007 GAGGAGTGGAAAAGTGAGGAAGG + Intronic
997214161 5:132096621-132096643 AAGGAATAGAGGACAGAGGCTGG + Intergenic
997744433 5:136286802-136286824 GAGGAGATGAAGACCGAGGAAGG - Intronic
997817433 5:137032843-137032865 ATGGACTTGAAGGCTGAGGATGG + Intronic
998369201 5:141650465-141650487 CCAGAGTAGAGGACTGAGGATGG - Intronic
998556983 5:143135037-143135059 AAGGAGTTCAAAACTGAGTAAGG + Intronic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
999261489 5:150241435-150241457 ACGGAGTAAAAGAGAGAGGAGGG - Intronic
1001126442 5:169023873-169023895 AAGGAATGAAAGACTGAGGCTGG + Intronic
1001347936 5:170924239-170924261 AAGGAATAAAAGACAGAGGCAGG - Intronic
1001378434 5:171284995-171285017 AAGGAGTAGAAGACTGGGCTTGG - Intronic
1001744648 5:174082992-174083014 AAGCAGAGGAAGCCTGAGGAAGG - Intronic
1002077001 5:176714250-176714272 AAGGAGGAGATGAGTCAGGAAGG - Intergenic
1002211637 5:177602827-177602849 AAGGAACAGATGAGTGAGGAAGG + Intronic
1002891243 6:1334489-1334511 AAGGAGGAGAAAACAAAGGAGGG + Intergenic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1004284118 6:14304808-14304830 AAGGCATGGAAGAGTGAGGAAGG + Intergenic
1004945583 6:20609260-20609282 AAGGAGGAGAAGGAGGAGGAAGG - Intronic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005863483 6:29919404-29919426 AAGGATCACAAGACTCAGGATGG + Intergenic
1005913139 6:30327712-30327734 AATTTGTAAAAGACTGAGGAAGG + Intronic
1007075498 6:39063657-39063679 AAGGAGGAGAAGAAAGAGCAGGG + Intronic
1007712228 6:43831758-43831780 AAGGAGTAGAGAAGTGAGGCAGG + Intergenic
1007740776 6:44008293-44008315 CAGAAGTAAAGGACTGAGGAGGG + Intergenic
1009425281 6:63506962-63506984 AGGGAGTAGAAGAATGAGGAAGG + Intergenic
1010285849 6:74077045-74077067 AAGGACTAAACGACAGAGGAAGG + Intergenic
1012075906 6:94685607-94685629 ATGGAACAGAAAACTGAGGAAGG - Intergenic
1012306237 6:97661546-97661568 AAGGAAAAGAAGACTGAGAGAGG - Intergenic
1013313980 6:108923914-108923936 AAGGAGGAGGGGAATGAGGAGGG - Intronic
1014540699 6:122672202-122672224 AAGGAGGAGAAGAGTAGGGAAGG + Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1015333395 6:132007047-132007069 AAGGAGTGGACTAATGAGGACGG - Intergenic
1015885201 6:137910686-137910708 AAGGAGGAAGGGACTGAGGATGG + Intergenic
1016460508 6:144276130-144276152 AAAGAGGAGAAGACAGAGGGTGG + Intergenic
1017399392 6:154041857-154041879 AAAGGGTAGAAAAATGAGGAAGG - Intronic
1017731175 6:157317494-157317516 AAAGAGAAGAGGTCTGAGGAAGG - Intronic
1017755829 6:157528390-157528412 AAGTAGATGAAGACTGGGGATGG + Intronic
1018153213 6:160960137-160960159 AAGGAATACAAGACTGATCAAGG - Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018727897 6:166627512-166627534 AAGGAGTAGAAAGAGGAGGAGGG - Intronic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1020932343 7:14413582-14413604 AAGGAGAAGAAGCCTGAAGCGGG + Intronic
1021452600 7:20797142-20797164 TAGGTTTAGAAGTCTGAGGAAGG + Intergenic
1021453828 7:20807591-20807613 AATGTATAGAAGTCTGAGGAGGG - Intergenic
1021530321 7:21636862-21636884 CAGAAGTAAAAGACTGAGAAAGG + Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1022108832 7:27215376-27215398 AAGGAGGAGGAGAGTGAAGAAGG - Intergenic
1022452731 7:30530302-30530324 AAGGAGAATAAGACTGTGAATGG - Intronic
1023173658 7:37414397-37414419 AAGGTGGAGAAGAGAGAGGACGG + Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024819545 7:53311347-53311369 TAGGAGTTGAAGTCTGAGGCTGG + Intergenic
1025629538 7:63257292-63257314 ATGGAGTAGAAGAGTAAGGTTGG + Intergenic
1025652731 7:63486746-63486768 ATGGAGTAGAAGAGTAAGGTTGG - Intergenic
1025988887 7:66479743-66479765 AATGAGCAGAAGGCTGGGGACGG - Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1027572759 7:79891458-79891480 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1027631614 7:80613063-80613085 AAGTAGTAGTAGAGAGAGGAGGG + Intronic
1028124299 7:87094231-87094253 AAGCAAGAGAAGACTGAGGGAGG - Intergenic
1030266932 7:107630614-107630636 AAGAGATAGGAGACTGAGGAAGG + Intergenic
1030447180 7:109661078-109661100 AAGAAGTAGAAAACAGAGGGAGG + Intergenic
1031054428 7:116977981-116978003 GAGAAGTAGAAGCCAGAGGAGGG - Intronic
1033207662 7:139436685-139436707 AATGATTAGAAGACTCAGGAGGG - Intergenic
1033682913 7:143613614-143613636 AAGGAGTAGAGAACAGAGGAGGG - Intergenic
1033701698 7:143844028-143844050 AAGGAGTAGAGAACAGAGGAGGG + Intergenic
1034758741 7:153650520-153650542 AAGAAGTAAAAGCCTGAGGCAGG - Intergenic
1035110784 7:156479888-156479910 AAGGAGATGAAGACAGAGGGAGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036658135 8:10690823-10690845 GAGGAGGAGAGGAATGAGGAGGG - Intronic
1036719621 8:11161290-11161312 AAGGAGTAGAAGACTTACCAAGG - Intronic
1037244754 8:16820719-16820741 AAGAAGAACAAGACTAAGGATGG + Intergenic
1037753238 8:21696095-21696117 AAGGAGGAGGGGACAGAGGAGGG - Intronic
1037901190 8:22690540-22690562 AAGGAGAAGAAGGCGGAGAAGGG - Exonic
1037908331 8:22728409-22728431 AAGGAGCAGGAGACTGTGGAAGG + Intronic
1038355832 8:26828477-26828499 AAGGTGTTAATGACTGAGGAAGG - Intronic
1038433523 8:27518823-27518845 AAAGACTGGAAAACTGAGGAAGG - Intronic
1038590294 8:28831515-28831537 AAGGAGGAGAAGGCTAGGGAGGG - Intronic
1039768970 8:40663400-40663422 AAGGGTTTGAAGTCTGAGGAAGG - Intronic
1039986568 8:42452680-42452702 AAGGAGGAAAAGATGGAGGAGGG + Intronic
1040575163 8:48645684-48645706 GAGGAGCAGGAGACAGAGGAAGG - Intergenic
1040666213 8:49636721-49636743 AATGAGTAGAAGACTGGGGTTGG - Intergenic
1041113266 8:54507535-54507557 CAGTAGCAGAAGACTGAGGCTGG + Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1042675786 8:71320052-71320074 AAGAACTAGCAGAGTGAGGATGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042978886 8:74503305-74503327 AAGGAATAAAGGACTCAGGAGGG - Intergenic
1043086172 8:75836170-75836192 TAGTAGAAGAAGACTGAGGGAGG - Intergenic
1043139692 8:76572814-76572836 AAGAACTAGAAGATTGAAGAAGG + Intergenic
1043296057 8:78665452-78665474 CAAGAGTAGAAGACAGAGGGAGG + Intergenic
1043500112 8:80845182-80845204 AATCAGTATAAGAGTGAGGAAGG - Intronic
1043632583 8:82354857-82354879 AAGGAGATGAATACTGAAGAAGG + Intergenic
1043796791 8:84552626-84552648 AAGGAGTCTAAGACTAAGTAGGG - Intronic
1044360940 8:91282886-91282908 GAAGAGTAGATGCCTGAGGAGGG - Intronic
1044376026 8:91472051-91472073 AAGGAATAAAAGATTGATGAAGG + Intergenic
1044397593 8:91731129-91731151 AAGGATTAGAAGATTAAGCAAGG + Intergenic
1044491042 8:92815363-92815385 AACCAGGAGAAGGCTGAGGAAGG + Intergenic
1044920901 8:97168363-97168385 AAGGACTGGAAGACAGAGGCTGG - Intergenic
1045073675 8:98539152-98539174 AAGGAGTAAATCACTAAGGATGG - Intronic
1045909295 8:107387182-107387204 AAGTGGTAGAAGACAGAGAAAGG + Intronic
1046072969 8:109281458-109281480 AAGGAGTGAAAGAGGGAGGAAGG - Intronic
1046538280 8:115544853-115544875 AAGGAGGAGAAGAAGGTGGAGGG + Intronic
1048262850 8:132960387-132960409 AAGGAACTGAAGACTGAGCAGGG + Intronic
1048272508 8:133040774-133040796 AAAAAGTAGAAGACACAGGAAGG + Intronic
1048417597 8:134243792-134243814 AAGGAGGAGAAGGAGGAGGAAGG + Intergenic
1048502860 8:134994503-134994525 AAGGAGAAGATGCCTGTGGAAGG + Intergenic
1049009341 8:139876818-139876840 AAGGCCTAGAAGAGTGAGGTGGG - Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049454853 8:142681637-142681659 GAGGAGTGGAAGATGGAGGATGG - Intronic
1050498377 9:6268091-6268113 AAGGGGTAAAAGACTGAAAAAGG - Intergenic
1050994612 9:12200465-12200487 AAGGACTAGAAGTCTGAGCTGGG + Intergenic
1051565869 9:18497358-18497380 TAGGAGTAGAAGCCTGAAGCTGG - Intronic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1053461507 9:38274819-38274841 AAGGAGCAGGAGGCTAAGGATGG + Intergenic
1055647981 9:78378715-78378737 AATGAGTAGGAGGCTGAGAAGGG + Intergenic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058892757 9:109374999-109375021 ATGGAGCTGTAGACTGAGGATGG + Intergenic
1059087143 9:111316423-111316445 AAAGCTTAGAAGACGGAGGAAGG + Intergenic
1059388941 9:113986756-113986778 AATGAGGAGAGGACAGAGGAAGG - Intronic
1059588816 9:115635264-115635286 CAGGAGCACAAGACAGAGGAAGG - Intergenic
1060477422 9:123997085-123997107 GAGGAGGAGAAGGCAGAGGAAGG - Intergenic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1061059140 9:128242042-128242064 ACAGAGTGGAAGACAGAGGAAGG - Intronic
1062037363 9:134388765-134388787 AAGGAGGAGGAGGCAGAGGAAGG - Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203461064 Un_GL000220v1:38383-38405 AAGTAGTAGAAGGTTGAGGGCGG - Intergenic
1185523701 X:760960-760982 AAGGAGGAGAAGGAGGAGGAGGG - Intergenic
1185535127 X:854999-855021 GAGGAGAAGAAGACAGAGAAAGG - Intergenic
1186047110 X:5548566-5548588 AAGGAGGAGAAGATAGAGAAAGG - Intergenic
1186908744 X:14139037-14139059 AAGGAGGAGAAGAAGGAGAAGGG + Intergenic
1186909477 X:14146660-14146682 AAAGAGCAGAAGACTCAGCAGGG - Intergenic
1187622963 X:21079007-21079029 GAGGAGATGAAGCCTGAGGAGGG - Intergenic
1187768446 X:22668907-22668929 AAGGAACAGATGACTGAGTATGG - Intergenic
1187855174 X:23629734-23629756 AACGAGGGGAAAACTGAGGAAGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188385772 X:29555833-29555855 AAGGAAAAGAACACTGGGGAGGG + Intronic
1188488543 X:30710707-30710729 AAAGACTAAAAGACTGAAGATGG - Intronic
1188702095 X:33277663-33277685 AAGGAGTAGGAGGCTGAGGGTGG - Intronic
1188913443 X:35879711-35879733 AGGGATCAGAAGACTGGGGATGG - Intergenic
1189172807 X:38925733-38925755 GTGGAGTAGGAGACTGTGGAAGG - Intergenic
1189178736 X:38983117-38983139 AAGGAGGAGGAGAGTGAAGAGGG + Intergenic
1189242207 X:39534049-39534071 AAGGAATAGAAGGCTCAGGGGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1189729880 X:44008573-44008595 AAGGAGGAGAAGAGGGAGGGAGG + Intergenic
1189904619 X:45744827-45744849 AAGGAGTGGAGGACTGGGCATGG + Intergenic
1190535140 X:51418403-51418425 AAAGAGTAGAAGAGGAAGGAGGG - Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1195331414 X:103805376-103805398 AAGTAGTAGAAAACTGAGTCAGG - Intergenic
1195895184 X:109739011-109739033 CAGGAGTTCAAGACTGAGGCAGG + Intergenic
1196418308 X:115496757-115496779 AAAGTGTAAAAGACTGATGAAGG - Intergenic
1196819486 X:119691881-119691903 AAGGAGTGGGAGACAGAGGTAGG - Intronic
1197390632 X:125859450-125859472 AAGAAGTGGTAGATTGAGGAAGG + Intergenic
1197441984 X:126502737-126502759 AAGCAGTAGCAGGTTGAGGATGG + Intergenic
1198741130 X:139844311-139844333 AAGGAGTAGCAGAGAGTGGAGGG + Intronic
1200081396 X:153578545-153578567 AAGGTGGAGAAGCCAGAGGAGGG + Intronic
1201888817 Y:18919175-18919197 AAGGTGTAGAAGAAGGAAGAAGG + Intergenic
1202365829 Y:24163701-24163723 AAGGAGAATAAGACTGTGAATGG + Intergenic
1202504953 Y:25506421-25506443 AAGGAGAATAAGACTGTGAATGG - Intergenic