ID: 1069252932

View in Genome Browser
Species Human (GRCh38)
Location 10:66294320-66294342
Sequence CTGTGGGTAGAGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069252929_1069252932 1 Left 1069252929 10:66294296-66294318 CCAATGAGAGTGTCTCAGGAAGC 0: 1
1: 0
2: 2
3: 16
4: 166
Right 1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069252932 Original CRISPR CTGTGGGTAGAGAGAGAAGA AGG Intronic
No off target data available for this crispr