ID: 1069254201

View in Genome Browser
Species Human (GRCh38)
Location 10:66311755-66311777
Sequence TTGTATATGGAAAAGGAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069254194_1069254201 23 Left 1069254194 10:66311709-66311731 CCACAACTAAAAATTTCTACATG 0: 1
1: 0
2: 4
3: 19
4: 306
Right 1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG No data
1069254198_1069254201 -5 Left 1069254198 10:66311737-66311759 CCTATATGCATAGAACTCTTGTA 0: 1
1: 0
2: 1
3: 11
4: 142
Right 1069254201 10:66311755-66311777 TTGTATATGGAAAAGGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069254201 Original CRISPR TTGTATATGGAAAAGGAATA TGG Intronic
No off target data available for this crispr