ID: 1069259061

View in Genome Browser
Species Human (GRCh38)
Location 10:66371285-66371307
Sequence CTGTATATGTAAAAGTATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 420
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 387}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069259061_1069259062 13 Left 1069259061 10:66371285-66371307 CCTTTATACTTTTACATATACAG 0: 1
1: 0
2: 1
3: 31
4: 387
Right 1069259062 10:66371321-66371343 ATTTTATGAAGCTAGTGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069259061 Original CRISPR CTGTATATGTAAAAGTATAA AGG (reversed) Intronic
902904291 1:19543302-19543324 CTGTATCTGTAAATTTATGATGG + Intergenic
904118885 1:28182651-28182673 CAGTACATTTAAAGGTATAATGG - Intronic
904678535 1:32213197-32213219 CTCTATATTTAAAAGAAAAAAGG - Intronic
906933502 1:50191796-50191818 CTGTATGAGCAAAGGTATAAAGG + Intronic
907177068 1:52534191-52534213 CTGTAAATGTTAGAGTATGATGG - Intronic
908888898 1:68820260-68820282 TAGTATCTGCAAAAGTATAAAGG + Intergenic
909553367 1:76924899-76924921 CTGTTTTTGTAATACTATAAAGG + Intronic
909716932 1:78719645-78719667 CTGTATTTTTAAAAGGATTATGG + Intergenic
909888165 1:80968777-80968799 CTTTACAGGTAAAAGTCTAAGGG + Intergenic
910841590 1:91566916-91566938 CTTTATATATTAAAGTATAGTGG - Intergenic
913443848 1:118928570-118928592 CTGTATATGTAAATGTTTGGAGG + Intronic
914740842 1:150463652-150463674 TTTTAAATGTAAAAATATAAAGG + Intronic
916188416 1:162155217-162155239 ATGTATATATATATGTATAAAGG - Intronic
917428495 1:174940599-174940621 ATGTATATGCTAAAGTAGAAGGG - Intronic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919456578 1:197827608-197827630 CTGTATATCTAGGAGTAGAATGG - Intergenic
920680814 1:208071125-208071147 CTGGATTTGTAAAAGGATACAGG + Intronic
921547939 1:216494997-216495019 CTGTATATTTCAAATTATAGAGG + Intergenic
922284349 1:224155530-224155552 CTGTTTTTGCAAAAGTATATTGG + Intronic
922302603 1:224315622-224315644 CTGCTAATGTAAAAGTAAAATGG + Intronic
923817912 1:237401181-237401203 TTGTATATATAAAATTATATAGG - Intronic
1063270601 10:4506616-4506638 TTGTATATTTAAAAGTATCCTGG - Intergenic
1063599422 10:7466756-7466778 ATGTATTAGTAAAAATATAAAGG - Intergenic
1064819649 10:19312446-19312468 GTGTATATGTATATGTATAATGG + Intronic
1064840898 10:19590987-19591009 CTGTATGTGTCATATTATAATGG - Intronic
1064990246 10:21250492-21250514 ATGTATATGTATATATATAAAGG - Intergenic
1066284010 10:33946310-33946332 CTGAATATGTAAAAGAAGGAAGG + Intergenic
1066356617 10:34690748-34690770 CTGCGTCTGTAAAAGTAAAAAGG + Intronic
1067366334 10:45632685-45632707 CTGTATATATGAATGTGTAAGGG - Intronic
1069067940 10:63963810-63963832 GTGTATATGTATATGTATATAGG + Intergenic
1069259061 10:66371285-66371307 CTGTATATGTAAAAGTATAAAGG - Intronic
1069332090 10:67304950-67304972 CTATATATAAAAAGGTATAAAGG + Intronic
1069656424 10:70092635-70092657 ATGTACAGGTAAAAGAATAAAGG + Intronic
1070069088 10:73068504-73068526 CTTTGTATGTAAAGCTATAAGGG - Intronic
1070245475 10:74727544-74727566 CTGTCTATGTAGAAATCTAAAGG + Intergenic
1071195237 10:83151435-83151457 CAATATATGTAAAAGTTAAAAGG - Intergenic
1071312094 10:84352537-84352559 CTGTATATATAAAAGTTTGTTGG + Intronic
1071949901 10:90691269-90691291 CTTTCTATGTAAAAGATTAAAGG - Intergenic
1071976031 10:90956282-90956304 ATGTATATGTATATATATAATGG + Intergenic
1072738324 10:97894697-97894719 ATATATATGTAAAAGCATCAGGG - Intronic
1073871021 10:107864328-107864350 TTGGATATGTACAAGTATGAAGG + Intergenic
1074421326 10:113311238-113311260 CTGTACATGAAAATATATAAAGG + Intergenic
1077694314 11:4380221-4380243 ATGTATATCTCCAAGTATAAAGG + Intergenic
1078621576 11:12913440-12913462 ATGTATATGTATACGTATAATGG - Intronic
1078633747 11:13030073-13030095 CTGTAGTTGTAAAAGGATGAAGG + Intergenic
1085211269 11:74781341-74781363 TTGTGTATGAAAAACTATAAAGG - Intronic
1086065966 11:82745220-82745242 CTGTAACTGAAAAAGTACAAGGG + Intergenic
1087346649 11:96980138-96980160 ATTTGTATGCAAAAGTATAATGG - Intergenic
1087778550 11:102278945-102278967 CTGTATTTGCAAAGGCATAAAGG + Intergenic
1088531733 11:110817961-110817983 CAGTATATGCAAAAGCATGAAGG + Intergenic
1093258181 12:16899074-16899096 TTATATATATAAAAGCATAAAGG - Intergenic
1093272095 12:17076215-17076237 CTGTATGGGTAAATGTAGAAAGG - Intergenic
1093609000 12:21131454-21131476 CTTTATATTTAAATATATAAAGG - Intronic
1093662142 12:21769257-21769279 CTCTATAAGTAGAACTATAAAGG + Intronic
1093999031 12:25674545-25674567 ATGTATTTTTAAAAGTAGAAAGG + Intergenic
1094119539 12:26955827-26955849 GTATATATGTAGAAGTAGAATGG + Intronic
1094322280 12:29198531-29198553 ATTTAAATGTAAAAGAATAATGG - Intronic
1095636762 12:44443613-44443635 CTACAAATGTAAAATTATAATGG + Intergenic
1096796127 12:54078975-54078997 CTGTATATGCACAAATACAATGG + Intergenic
1097423080 12:59405627-59405649 TTCTATAGGTAAAAGTAAAATGG - Intergenic
1097615706 12:61881210-61881232 CTGTATATATAATATTATATTGG - Intronic
1097623165 12:61966104-61966126 CTGTAGATGGGAAAGTAAAACGG - Intronic
1097786182 12:63762417-63762439 ATCTAAATGTAAAATTATAAAGG - Intergenic
1098738701 12:74142444-74142466 ATCTATATGGAAAAGTAGAAAGG + Intergenic
1098828113 12:75325337-75325359 GTGTATCTCTTAAAGTATAAAGG - Intronic
1099520972 12:83662009-83662031 AAGTAAATGTAAAAATATAAGGG - Intergenic
1099782206 12:87210374-87210396 CTGTAAATGTAAAGGCACAAGGG + Intergenic
1100074669 12:90765435-90765457 CTGTATGTGTATATGTATTAGGG - Intergenic
1100790245 12:98122299-98122321 CTGTATAGGCAAAGGAATAAGGG + Intergenic
1101000244 12:100350566-100350588 GTGTATATGACAAAGTAGAATGG - Intergenic
1102125517 12:110477257-110477279 TTGTAAAGGTAAAAGTATATGGG + Intronic
1102774896 12:115509842-115509864 CTGTATATTTAAAGTTATAATGG - Intergenic
1102829817 12:115987512-115987534 CTCTATATAAAAAAGTTTAATGG + Intronic
1102883453 12:116503940-116503962 CAGCATATGCAAAAGTATACAGG - Intergenic
1104119871 12:125789022-125789044 ATGTATATGTATAAGAAAAAGGG + Intergenic
1104134337 12:125923215-125923237 CTGCCTGTGTAAAAGTAAAATGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1106494962 13:30267711-30267733 CTATGTATGTAAAAGGATATTGG - Intronic
1106887891 13:34209621-34209643 CTGTTTATGTAAATGTATTAGGG + Intergenic
1107618772 13:42202105-42202127 ATGTATATGTTAAATGATAAGGG + Intronic
1108250295 13:48560250-48560272 CTATTTATGTAACAGTTTAAAGG + Intergenic
1108339128 13:49479128-49479150 ATGTGTATATAAAAGCATAAAGG + Intronic
1108722090 13:53142535-53142557 CAGTATATGCAAAAGTGCAAAGG - Intergenic
1109117968 13:58413824-58413846 CTGTTTATGGAAAAGAAGAATGG + Intergenic
1109742378 13:66571401-66571423 TTGTACATGGAAAATTATAATGG + Intronic
1109892792 13:68638559-68638581 CTGCATCTGGAAAAGGATAAAGG + Intergenic
1109986631 13:69994598-69994620 ATGTATATGGAAAAGTACATTGG + Intronic
1110407217 13:75164272-75164294 CTGTATATCAAAAAGTAAATAGG + Intergenic
1110958587 13:81590588-81590610 ATGTATATGTATAAGCATTATGG + Intergenic
1111389031 13:87566809-87566831 CTGTATATAGAATAATATAATGG + Intergenic
1111683642 13:91475263-91475285 GTGTATATATTTAAGTATAAGGG - Intronic
1111782546 13:92746796-92746818 CTGTATATGTTAATGAATCAAGG - Intronic
1112371690 13:98799670-98799692 TTGTATATGTTATAGTGTAAGGG - Intronic
1115352674 14:32412268-32412290 CTGAATATGTAAATGTGTCAAGG - Intronic
1116683211 14:48003702-48003724 TTGTATATGAAAAACTATAAAGG + Intergenic
1116833852 14:49749244-49749266 ATGTATATGTGAATGTATAAAGG + Intronic
1117859138 14:60071559-60071581 GTGTAGAAGCAAAAGTATAAGGG + Intergenic
1118057078 14:62090194-62090216 GTGTATATGTACAGATATAATGG + Intronic
1119221469 14:72911433-72911455 GTGTATATGAAAATGTATACTGG - Intergenic
1119463507 14:74832899-74832921 CTGTAGATTTAAAAGTAGCAAGG + Intronic
1120097901 14:80409712-80409734 CTGTTTTTGTGAAACTATAAAGG - Intergenic
1120504050 14:85332396-85332418 CTGTAGCTTTAAAAATATAAGGG - Intergenic
1120831482 14:89001138-89001160 CAGCATGTGTAAAAGTATGATGG + Intergenic
1121773011 14:96568022-96568044 CTGAATTAGTAAAATTATAATGG + Intergenic
1123821664 15:24036562-24036584 CTGATTATGTAACAGCATAAAGG + Intergenic
1124190316 15:27569671-27569693 ATGTAAATGTAAACGTAAAATGG - Intergenic
1124322063 15:28721465-28721487 CTTTCTAAGTAAAAGTTTAATGG + Intronic
1124523163 15:30423307-30423329 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124535503 15:30542909-30542931 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1124552930 15:30698446-30698468 CTGCATATGTAAAAGACTAAAGG - Intronic
1124678313 15:31707224-31707246 CTGCATATGTAAAAGACTAAAGG + Intronic
1124763151 15:32464687-32464709 CTTTCTAAGTAAAAGTTTAATGG + Intergenic
1124775476 15:32584372-32584394 CTTTCTAAGTAAAAGTTTAATGG - Intergenic
1125208024 15:37177089-37177111 CAGTATATGGAAAAGTCTAATGG - Intergenic
1126621910 15:50648561-50648583 TTGTATATTTTAAAGTACAAAGG - Intronic
1126652868 15:50943559-50943581 CTGTATCTGTTAAAGCAGAACGG - Intronic
1126741806 15:51784792-51784814 CTTTGTATGTAAATGAATAAAGG + Intronic
1127185664 15:56477513-56477535 CTGTACATGTAGTAGTATAAAGG + Intergenic
1128427580 15:67557860-67557882 TTGTATATGTAAAAATATAAAGG + Intronic
1129368931 15:75075519-75075541 TTGTATAAGAAAAAGTAAAATGG + Intronic
1131643417 15:94316141-94316163 CTGTACATTTAAAAATATACAGG - Intronic
1133658837 16:7894481-7894503 ATGTATATGTATACATATAATGG + Intergenic
1134505257 16:14800537-14800559 CTGTATCTTCAAAAGTATCAAGG - Intronic
1134575319 16:15328373-15328395 CTGTATCTTCAAAAGTATCAAGG + Intergenic
1134727126 16:16428119-16428141 CTGTATCTTCAAAAGTATCAAGG - Intergenic
1134940311 16:18283736-18283758 CTGTATCTTCAAAAGTATCAAGG + Intergenic
1137372900 16:47925215-47925237 CTGTTTATGTAGCAGAATAAAGG + Intergenic
1138398282 16:56724835-56724857 CTGTATATAAAAAAATAGAAAGG - Intronic
1139218406 16:65152600-65152622 CTCTATAGGTAAAAGTTTTAAGG - Intergenic
1139223747 16:65213576-65213598 CTTCATATGTAAAATTATAATGG - Intergenic
1139907061 16:70373491-70373513 CTGTTTTTGTAAAAGAAAAATGG - Intergenic
1140653763 16:77118202-77118224 CTGATTCTGTAAAAATATAAGGG + Intergenic
1140842916 16:78858382-78858404 ATGTATCTGTATATGTATAATGG + Intronic
1143034814 17:3988643-3988665 CTTTACATGTTAAAGCATAATGG + Intergenic
1143682192 17:8484488-8484510 TTGTAAATATAAAAGTATATGGG + Intronic
1143693444 17:8590702-8590724 CTGTGTAAGTAAATGAATAAAGG - Intronic
1144808426 17:17982997-17983019 CTGTATATGTAACACTCTAGAGG - Intronic
1146253723 17:31375599-31375621 CTTTATATGTTAAGATATAATGG + Exonic
1147047096 17:37760970-37760992 CTATATATGTATACATATAATGG - Intergenic
1149328033 17:55552844-55552866 GTATATATGTTAAAGTGTAAAGG - Intergenic
1151372978 17:73661055-73661077 CTGTATATTTAAAAGTAATTTGG + Intergenic
1152050869 17:77975499-77975521 CTTTATAGGCAAAATTATAAGGG - Intergenic
1153328214 18:3843704-3843726 CTGTCTTTGTAAAACTATATTGG - Intronic
1155554900 18:27007887-27007909 CTGTATCTGGAAAAGGATACAGG + Intronic
1155966584 18:32041207-32041229 ATGTATATGTGAAAGAACAAGGG + Intronic
1156805178 18:41169829-41169851 ATATATATATAAATGTATAAGGG + Intergenic
1157173392 18:45428623-45428645 CTGTACTTGGAAAAGTAGAAAGG + Intronic
1158020401 18:52834907-52834929 CTATATATGTATATGTATATTGG + Intronic
1159115538 18:64108810-64108832 CTGTCTGTGTAAAAATATATAGG + Intergenic
1160570557 18:79814776-79814798 ATGTATATGTATATGCATAAAGG + Intergenic
1162274567 19:9642576-9642598 TTAAATATGTAAAAGAATAAAGG - Intronic
1167813782 19:51860064-51860086 CTGTATATATAATTTTATAATGG - Intronic
1168159105 19:54496983-54497005 CTGTATATACAAAAGTGCAAGGG + Intergenic
1168529302 19:57114919-57114941 ATGTATATCTAAAGGTGTAAGGG + Intergenic
927103215 2:19803681-19803703 CAGCATATGTAAAGGTATGAAGG + Intergenic
927561012 2:24073571-24073593 TTGAAGATGTAAAAGTATAGAGG - Intronic
927581121 2:24248924-24248946 ATCCAAATGTAAAAGTATAAAGG + Intronic
930468480 2:51783193-51783215 TTGGATGTGTGAAAGTATAAGGG - Intergenic
930856894 2:56028567-56028589 CAGTGGATGTAAAAGTATAAGGG - Intergenic
933396975 2:81744922-81744944 TTGTATATGTTGAAATATAAGGG + Intergenic
933846317 2:86329812-86329834 CTGCATATGAGAAACTATAAGGG + Intronic
933915825 2:86992381-86992403 CTGCAGAGGTAAAGGTATAAGGG + Intronic
934007168 2:87777521-87777543 CTGCAGAGGTAAAGGTATAAGGG - Intronic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
935770808 2:106418426-106418448 CTGCAGAGGTAAAGGTATAAGGG - Intronic
935909274 2:107877511-107877533 CTGCAGAGGTAAAGGTATAAGGG + Intronic
935967410 2:108494512-108494534 CTGCAGAGGTAAAGGTATAAGGG + Intronic
936131053 2:109842651-109842673 CTGCAGAGGTAAAGGTATAAGGG + Intronic
936213644 2:110528834-110528856 CTGCAGAGGTAAAGGTATAAGGG - Intronic
936404468 2:112189885-112189907 CTGAATATTTAAAGGTATTAAGG - Intergenic
936422782 2:112383394-112383416 CTGCAGAGGTAAAGGTATAAGGG - Intronic
937579761 2:123470531-123470553 CTGTGTATGTCAAAGTAAGAGGG + Intergenic
938647293 2:133344893-133344915 CGGGATATGCAAAAGTCTAAAGG + Intronic
939086099 2:137720298-137720320 ATATATATGTATATGTATAAAGG - Intergenic
939385817 2:141495984-141496006 ATTTATATGTAAAACTATCATGG + Intronic
939467248 2:142573987-142574009 ACATATATGTAAAAGTAAAAGGG + Intergenic
940235128 2:151503063-151503085 CTGGAAATGAAAAAGTACAATGG + Intronic
940595922 2:155792945-155792967 ATATATGTCTAAAAGTATAAAGG + Intergenic
941327417 2:164134065-164134087 CTGTCTAGGTAAAAGAAGAATGG - Intergenic
941541090 2:166785348-166785370 CTGTAAAGTTAAAAGTAAAATGG + Intergenic
941771742 2:169352561-169352583 CTGTATTTTTAAAAGTTTCAAGG - Intronic
941913967 2:170795889-170795911 TTGTAAATGTTAAAGAATAATGG + Intronic
942022731 2:171882885-171882907 CTGGACGTGTAAAAGAATAACGG - Intronic
942403538 2:175628950-175628972 CTTTATAAGTAAAAGGATAAAGG - Intergenic
943114022 2:183643930-183643952 CTGTGTATGCAAAATTAGAAGGG + Intergenic
943175689 2:184470746-184470768 CTAAAAATGTAAAAGTAAAATGG - Intergenic
943290235 2:186061735-186061757 AAGTATATGAAAAAGTACAATGG + Intergenic
943714306 2:191133515-191133537 CTGCATATATACATGTATAAGGG + Intronic
944028689 2:195205027-195205049 ATGTAAATCTGAAAGTATAAAGG + Intergenic
944176762 2:196838560-196838582 CTGTATATATACACATATAATGG + Exonic
944590689 2:201214795-201214817 GTGTATATTTAAAGCTATAAGGG + Intronic
945147852 2:206757713-206757735 TTGCATGTGTAAAAGAATAAGGG - Intronic
945442397 2:209895742-209895764 CTCTCTGTGTGAAAGTATAAAGG - Intronic
946267694 2:218561908-218561930 CTGTGTATGCAAAGGTATAGTGG - Intronic
947052834 2:226066075-226066097 ATTTATATTTAAAAGTAGAAGGG - Intergenic
947939924 2:234044240-234044262 CTGTTTATGTGAATGTAAAATGG + Intergenic
1170086652 20:12540610-12540632 TTGTACTTGTAAAATTATAAAGG - Intergenic
1171847629 20:30287013-30287035 CTGTATATGCACAAATACAATGG + Intergenic
1172051854 20:32123643-32123665 ATGTATATATAAATGTATAAGGG - Intronic
1175114684 20:56673803-56673825 CAGTATATGCAAAGGTATGATGG + Intergenic
1177087146 21:16720052-16720074 CTGTATCTGGAAAACTATAAGGG + Intergenic
1177519450 21:22199844-22199866 CAGGAAGTGTAAAAGTATAAAGG - Intergenic
1178137563 21:29644900-29644922 CTTTATCTGTAAAAGAATAAAGG - Intronic
1178289083 21:31351194-31351216 CTCTATATGTAAGAGAAGAAAGG + Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
949967459 3:9370096-9370118 AAGTATATTTAAAAGTTTAAGGG - Intronic
950006339 3:9693866-9693888 CTGTATATGGAAAAGCCTAGTGG + Intronic
951691515 3:25401377-25401399 TTGTATATGAAAAATTATAAAGG - Intronic
952162483 3:30707766-30707788 CTGGATATCTAGAAGGATAATGG + Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
954011106 3:47639146-47639168 CTGTATGTATTAAAATATAAAGG + Intronic
954545909 3:51434433-51434455 CTAAATATGTAATAGTAAAATGG - Intronic
954963497 3:54588260-54588282 TTGTATTTTTAAAATTATAAAGG - Intronic
955627692 3:60936490-60936512 CTCTATATGTAAAATGTTAAGGG + Intronic
956877935 3:73481780-73481802 GTGTAATTTTAAAAGTATAATGG + Intronic
957023010 3:75144889-75144911 CTGTATATGTTGAACTTTAATGG + Intergenic
957028336 3:75210816-75210838 TTGTATAAGTAAAAATATAAAGG - Intergenic
957211709 3:77267512-77267534 ATGTATATTTGAAAGAATAAGGG + Intronic
957352310 3:79041193-79041215 CTATATAAATGAAAGTATAAGGG - Intronic
957661936 3:83168237-83168259 CTTAATATGTAACAGAATAAAGG + Intergenic
958427066 3:93990971-93990993 CTATATATGTAAGATGATAATGG - Intronic
958487746 3:94733015-94733037 CTGCATTTGGAAAAGCATAAAGG + Intergenic
958974273 3:100648550-100648572 ATGTTTATGAAAAAGTAAAATGG + Intronic
959461571 3:106632069-106632091 CCGTATATGTAAAGGCATAGAGG - Intergenic
959627420 3:108468319-108468341 CTGTATACGTATAAGAAAAAAGG - Intronic
959883799 3:111475803-111475825 CTGTATATGTAGAGGAAGAAAGG + Intronic
960345764 3:116530360-116530382 CTGTATAGGTAGAAGTTTAAAGG + Intronic
962029074 3:131580385-131580407 ATGTATATGTATATGTATAGAGG - Intronic
962178565 3:133181204-133181226 CCGTATCAGTAAAAGTATAGAGG + Intronic
963550815 3:146720608-146720630 CTGTATATGTACAATTTTTATGG - Intergenic
964006598 3:151836535-151836557 CTGTAAATGAAAAATTTTAAAGG - Intergenic
964047784 3:152351558-152351580 CCATATATGTACAAGTAAAAAGG - Intronic
964723260 3:159789086-159789108 CTGTATATGTGTATGTATACAGG + Intronic
965138437 3:164804585-164804607 ATATATATGTATATGTATAAAGG - Intergenic
965629171 3:170713220-170713242 CTGTATATTTGAAATTATAGAGG + Intronic
966046619 3:175558730-175558752 CTGTATATGTATGAGTTTATCGG + Intronic
966050222 3:175607462-175607484 GTGTATATGTAAATCTATCAAGG - Intronic
966177057 3:177149880-177149902 CTGTTTATGTAAAGGATTAAGGG - Intronic
967794137 3:193580064-193580086 CTGGATATGTTAAAGTAAAAAGG + Intronic
967801766 3:193669930-193669952 TTGTACATATAAAATTATAATGG + Intronic
968769935 4:2498626-2498648 TTGTATATGTAAGATTATCACGG + Intronic
968820442 4:2846103-2846125 CTGGATATTTGAAAGTATTAAGG - Intronic
968895786 4:3402380-3402402 CTGAGTGTGTAAAAGCATAAAGG - Intronic
971916185 4:32872694-32872716 CCATATATTCAAAAGTATAATGG + Intergenic
972372802 4:38441395-38441417 CTGTATATCTAACAGTGAAAGGG + Intergenic
972911346 4:43821328-43821350 CTTTATATGTAATAATATATTGG - Intergenic
972980486 4:44694268-44694290 CTGTATATGTAATATTTTGATGG + Intronic
974430196 4:61786774-61786796 CTAGATATGTGAAAGCATAATGG - Intronic
974450017 4:62042422-62042444 TTTTATATTTAAAAGAATAAAGG + Intronic
975546207 4:75562663-75562685 CTGTATATGTAAGCCTCTAAGGG + Intronic
976421203 4:84846461-84846483 CTGTGGATGTAAAATCATAAAGG + Intronic
976718494 4:88148289-88148311 CTGTAGATGGAAAAGAAGAAAGG + Intronic
977377267 4:96221376-96221398 CTGTAAATGCAAAATGATAAAGG + Intergenic
978054136 4:104242058-104242080 ATGTATATTTAAAATTATATTGG + Intergenic
978101639 4:104848565-104848587 CTGTACTTTTAAAAGTATCAAGG - Intergenic
978167396 4:105625419-105625441 CTCTATGTGTAAAAGTCTGAAGG + Intronic
978380019 4:108117221-108117243 GTTTATATGTGAAGGTATAATGG - Intronic
979124709 4:116954304-116954326 CTGTCTATGGAGAAGTAAAATGG - Intergenic
979806630 4:124980851-124980873 CTGTCTCTGTAAAATAATAATGG + Intergenic
979938529 4:126728588-126728610 ATTTATTTATAAAAGTATAAAGG + Intergenic
980199929 4:129643069-129643091 CTGTATATTAAAAACTATAAAGG + Intergenic
980208367 4:129752206-129752228 CTGAATGTGTAAAAGCACAAAGG + Intergenic
980587896 4:134841920-134841942 CTGTGTATGTGAAAGTAAAAGGG - Intergenic
980701034 4:136430264-136430286 CCATATATTTAAAAGTATTAGGG + Intergenic
980873901 4:138641201-138641223 CAGAATATGGAAAAGAATAATGG - Intergenic
981922593 4:150101506-150101528 CTGAATATGTGAAAAAATAATGG + Intronic
982381882 4:154757730-154757752 CTTTATATTTAAAAATATAAAGG + Intergenic
983041048 4:162927015-162927037 ATGTATACATTAAAGTATAATGG + Intergenic
984038791 4:174703273-174703295 CCCTAGAGGTAAAAGTATAAAGG + Intronic
984083003 4:175273099-175273121 CTTCATATGTAAAAATATAAAGG - Intergenic
984090139 4:175363266-175363288 ATGTATATTTAAAAGGATGAAGG - Intergenic
984112596 4:175637508-175637530 TTATATATATAAAAATATAAAGG - Intronic
984374438 4:178909573-178909595 CTTTATATGCAAATGTCTAATGG + Intergenic
986227560 5:5829667-5829689 CAGTATATCTAAAAATAAAATGG - Intergenic
987811327 5:22839810-22839832 CTGAACATTTAAAAGCATAAAGG + Intronic
988005539 5:25405773-25405795 CTATATATGAAAAAATTTAATGG - Intergenic
988341487 5:29978058-29978080 CTGTATAATTAAATGTGTAAAGG - Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
989469871 5:41803215-41803237 CTGTATATGTAGAAGATTTATGG - Intronic
991496586 5:67232798-67232820 CTGTCTTTGCAAAAGTATGATGG + Intergenic
991648374 5:68824723-68824745 ACATATATGTAAAAGAATAATGG - Intergenic
992203203 5:74404051-74404073 CTGAATCTGTAAAATTAAAATGG - Intergenic
993076423 5:83237697-83237719 CTGTATATTTCAAAATAAAAGGG + Intronic
993812223 5:92495148-92495170 CGGTAATGGTAAAAGTATAATGG - Intergenic
994180692 5:96762714-96762736 ATGTATAAGAAAAAATATAAAGG - Exonic
994294123 5:98068397-98068419 AGGCATATGTAAAAGTATGAAGG + Intergenic
994687003 5:102968246-102968268 ATGTATAGGAAAAAGTGTAATGG + Intronic
994888401 5:105597326-105597348 ATGTATATGTATATGTATGATGG + Intergenic
994954235 5:106506765-106506787 ATGCAAATGTAAAACTATAATGG + Intergenic
996940325 5:128997461-128997483 CTGTAAATGTAGAAATACAAGGG + Intronic
997048029 5:130343394-130343416 ATGCCTATGTAAAAGTATAAAGG + Intergenic
997139576 5:131364296-131364318 CTGTATAGGCACAAGTTTAAGGG + Intronic
997155387 5:131550777-131550799 CTGCATATGTAAAGGTCTGAAGG - Intronic
997380796 5:133436156-133436178 AAGTATATGTAAAATTACAATGG + Intronic
997673356 5:135694415-135694437 CTAAATATGTAAATATATAAAGG - Intergenic
999353415 5:150900344-150900366 CAGCATTTGTAAAAGTAGAAAGG - Intronic
1000480730 5:161770310-161770332 ATGTATATGTAAGTGTATATCGG - Intergenic
1000712192 5:164594610-164594632 CTGTATATATATGAGTAGAAAGG - Intergenic
1001908860 5:175497187-175497209 TTATATATATAAAAGTATATAGG - Intronic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1004057709 6:12157593-12157615 CAGTAGATGTAAATGTAAAAAGG - Intronic
1004421752 6:15476709-15476731 CTGTATATGGAAGAGTATTTTGG - Intronic
1004786079 6:18968680-18968702 TTGTATAGGCAAATGTATAATGG - Intergenic
1004879444 6:19992706-19992728 ATGTATATAAAAAATTATAATGG + Intergenic
1005458694 6:26046612-26046634 CTGTAAATATAAATTTATAATGG + Intergenic
1005522273 6:26611804-26611826 CTGTATATGTAGGAGAATTAAGG + Intergenic
1005726902 6:28658189-28658211 CTGTATCTGTAAAAGAAAGACGG + Intergenic
1006484197 6:34324630-34324652 CTATATATTTAAAACTAAAATGG + Intronic
1007202648 6:40123162-40123184 CTGAATAAGCAAAAGTTTAATGG + Intergenic
1008075559 6:47141782-47141804 GTTTCTATTTAAAAGTATAATGG - Intergenic
1008475353 6:51930400-51930422 GTGTATATGTGAGTGTATAAGGG + Intronic
1009041099 6:58178101-58178123 CTGTATATTTGCAAGTTTAAAGG - Intergenic
1009216958 6:60932638-60932660 CTGTATATTTGCAAGTTTAAAGG - Intergenic
1009288857 6:61859124-61859146 ATGTATATTTAAAATTATATAGG + Intronic
1009836954 6:69013522-69013544 TGGTAGTTGTAAAAGTATAATGG + Intronic
1009857244 6:69280508-69280530 CTTTATATGTATAAGTCTAATGG - Intronic
1010121690 6:72383314-72383336 CTGTATATGTAAGTGTGAAAAGG - Intronic
1011029544 6:82907057-82907079 CTGTATGGGTAAAAGAAAAATGG + Intronic
1011034703 6:82960412-82960434 CTGTATATGTAAGACAATAGTGG - Intronic
1011817054 6:91204894-91204916 CTATATATGTATGAGTATAGAGG - Intergenic
1012742446 6:103035559-103035581 CTGTTTGTGTGAAAGTAAAATGG - Intergenic
1013623648 6:111916195-111916217 ATGTGTATATAAAGGTATAAAGG + Intergenic
1014156826 6:118120477-118120499 CTGTATATGTAAACTTAGGAGGG + Intronic
1014348765 6:120311832-120311854 GTGTACATGTGAAATTATAATGG + Intergenic
1014589084 6:123239778-123239800 ATACATATGTAAAAGTAGAAAGG + Intronic
1014975836 6:127881874-127881896 CTTTATTTTTAAAAATATAATGG + Intronic
1014988983 6:128050329-128050351 CTGTATATTTGAAAGCAAAAAGG - Intronic
1015083123 6:129252456-129252478 CTGCATATTTAAAACTGTAAAGG - Intronic
1016123374 6:140370999-140371021 TTTTATGTGTAAAAGTAGAATGG - Intergenic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1017383002 6:153851523-153851545 CTATATATATATATGTATAAAGG - Intergenic
1017418445 6:154246670-154246692 CTGTATAAGAAAAAGGAAAAGGG - Exonic
1018884020 6:167917070-167917092 TTGCCTATGTAAAAGAATAAAGG - Exonic
1019805260 7:3118925-3118947 CTGTATTTCCAAAAGTCTAATGG - Intergenic
1020442451 7:8232844-8232866 TTGTAAATGTAAATGCATAATGG - Intronic
1020841856 7:13227740-13227762 CTGTATATGGTAAAGTGTGATGG + Intergenic
1021731692 7:23601417-23601439 CTGTATATGTAAAAATAAACTGG + Intronic
1021892291 7:25197565-25197587 ATGTATATGTATACATATAAAGG + Intergenic
1023614490 7:42006132-42006154 CTGTACTTAAAAAAGTATAAGGG + Intronic
1023645755 7:42313062-42313084 CTCAATATTTAAAAATATAATGG - Intergenic
1024811573 7:53218675-53218697 CTGTATATCTGTAAATATAAAGG - Intergenic
1025226486 7:57169273-57169295 ATATATATTTAAAGGTATAAGGG - Intergenic
1025229539 7:57192538-57192560 ATGTATATTTAAAGGTATAAGGG - Intergenic
1025730808 7:64105430-64105452 ATGTATATTTAAAGTTATAAGGG + Intronic
1026432582 7:70361872-70361894 ATGTATATGTATATGTATATAGG + Intronic
1027605086 7:80289726-80289748 ATATATATGTAAATATATAATGG + Intergenic
1028270648 7:88784587-88784609 GAGTATATTTAAAAATATAAAGG - Intronic
1028445678 7:90920618-90920640 ATCTATATGTATAAATATAAAGG - Intronic
1028468703 7:91181105-91181127 CTGAATATTTAATAGTATTAAGG - Intronic
1028699095 7:93755906-93755928 ATGTAAATGAAAAAATATAAAGG - Intronic
1030541433 7:110835295-110835317 CATTATATGTTAAAGAATAAAGG + Intronic
1031064051 7:117085077-117085099 CTGTACAAGAAAAAGAATAAAGG + Intronic
1031187575 7:118502174-118502196 ATGCATATTTATAAGTATAATGG - Intergenic
1031539533 7:122976853-122976875 CTGTCTCTGTAAAATAATAATGG + Intergenic
1031558438 7:123207584-123207606 ATGCATATTTCAAAGTATAAAGG - Intergenic
1031822741 7:126525064-126525086 CTGTTGATGTAGAATTATAATGG + Intronic
1032130878 7:129226015-129226037 CTGAATATGTAAAAGGGTAATGG + Intronic
1038088496 8:24227365-24227387 ATGTATATGTATATGTATATGGG + Intergenic
1038610616 8:29057273-29057295 ATGAATATATAAAAATATAATGG + Intronic
1038826822 8:31012389-31012411 ATTTATATGTAAAATTAAAATGG + Intronic
1039681464 8:39742122-39742144 CTGAAATTGTAAAAGTATAGGGG - Intergenic
1040365033 8:46706448-46706470 CTGTATAACCAAAATTATAATGG - Intergenic
1040747735 8:50665894-50665916 CTGTAATTATAAAAGAATAAAGG + Intronic
1040791997 8:51241994-51242016 CTTAATATTAAAAAGTATAAAGG - Intergenic
1041630009 8:60076727-60076749 CTGAACATGTAAAAATAAAAAGG + Intergenic
1041920153 8:63173110-63173132 CTGTATTTATAATAGTATATGGG + Intronic
1042885998 8:73552599-73552621 CTGAATGTGTGGAAGTATAATGG + Intronic
1043007449 8:74837169-74837191 ATGTATATCAAAAAATATAAAGG - Intronic
1043264541 8:78247507-78247529 CAGTTTATCAAAAAGTATAATGG - Intergenic
1044372694 8:91431723-91431745 CTATATATATATAAGTGTAAAGG - Intergenic
1045581713 8:103488379-103488401 CTGTTTATGTAAAATCATATAGG - Intergenic
1050387631 9:5107769-5107791 ATGTATATTTAAAGTTATAAGGG - Intronic
1051209461 9:14726425-14726447 TTGTTTATTTAAAAGTTTAAGGG - Intergenic
1051799301 9:20913925-20913947 CTGTGTATATATGAGTATAAAGG + Intronic
1051986442 9:23095056-23095078 ATGTATCTGTAAAAATAAAATGG - Intergenic
1052908407 9:33857763-33857785 CTATATACTTAAAAGCATAAAGG - Intronic
1053619009 9:39797566-39797588 TAATATATGTAAAAGTAAAATGG - Intergenic
1053785737 9:41651651-41651673 CTGTATATGCACAAATACAATGG + Intergenic
1053877174 9:42556915-42556937 TAATATATGTAAAAGTAAAATGG - Intergenic
1053895495 9:42737779-42737801 CAATACATGTAAAAGTAAAATGG + Intergenic
1054159300 9:61662532-61662554 CTGTATATGCACAAATACAATGG - Exonic
1054174454 9:61865617-61865639 CTGTATATGCACAAATACAATGG + Intergenic
1054234521 9:62544807-62544829 TAATATATGTAAAAGTAAAATGG + Intergenic
1054265147 9:62909863-62909885 TAATATATGTAAAAGTAAAATGG + Intergenic
1054449311 9:65394662-65394684 CTGTATATGCACAAATACAATGG + Intergenic
1054479074 9:65593537-65593559 CTGTATATGCACAAATACAATGG - Intergenic
1054663084 9:67715174-67715196 CTGTATATGCACAAATACAATGG - Intergenic
1054986808 9:71271142-71271164 CTCTATATGAGAAGGTATAATGG - Intronic
1055756261 9:79561456-79561478 CTGAATATTTAAATATATAAAGG - Intergenic
1057538661 9:95943473-95943495 CTGTTTATGTAGATGTAGAATGG + Intronic
1059621136 9:116006851-116006873 TAGTATATGCAAAAGCATAAAGG + Intergenic
1060448413 9:123713915-123713937 CTCCATATGTAAAGGTATAGTGG - Intronic
1061771355 9:132925740-132925762 CTGAAAATGTAAAAGAACAAGGG + Intronic
1186015481 X:5187493-5187515 CTGTAAATGTGAAAATATATTGG + Intergenic
1186365045 X:8883451-8883473 TTGTAAATGTAAAAGGAAAATGG - Intergenic
1187028221 X:15457841-15457863 CTGTTTTTGTAAAAGTTTATTGG + Intronic
1187065110 X:15827074-15827096 CTGGATATTTTAAAGTTTAAAGG - Exonic
1187360949 X:18627340-18627362 CTGTAAATGTCATGGTATAAGGG - Intronic
1187786001 X:22887346-22887368 ATGTATATGGCAAAGTATAAGGG + Intergenic
1187967502 X:24627052-24627074 ATGTATGTGTAAATATATAAAGG + Intronic
1188145056 X:26601825-26601847 CTGTATAGGTATAACTAAAATGG - Intergenic
1188587508 X:31795917-31795939 GAATATATGTTAAAGTATAAAGG + Intronic
1190002662 X:46704565-46704587 CTGTCTTTGTAAATGCATAAAGG - Intronic
1190587113 X:51956824-51956846 ATTTATATGTAGAAGAATAAAGG - Intergenic
1190780196 X:53586655-53586677 CTGTAGTTTTAAAATTATAAAGG - Intronic
1192013798 X:67305692-67305714 CTGTATATGGAAAACCCTAAAGG + Intergenic
1192983609 X:76372849-76372871 TTTTATCTGTCAAAGTATAAGGG + Intergenic
1193336969 X:80301516-80301538 TTGTATATGGAAAAAGATAAAGG + Intergenic
1196406498 X:115367919-115367941 CTGTATATTAAAAAAAATAATGG - Intergenic
1197270451 X:124419336-124419358 GTGGAGATGTTAAAGTATAAGGG - Intronic
1197329532 X:125136850-125136872 CATTATATGCAAATGTATAAGGG + Intergenic
1197341485 X:125276051-125276073 TTATATATGTATAAATATAATGG + Intergenic
1197349107 X:125360275-125360297 ATATATATGTAAAAGCAGAATGG + Intergenic
1197637765 X:128934509-128934531 GTGTATATGTCAAAATATCATGG + Intergenic
1198791387 X:140350722-140350744 CTTTAAATGTAACAGTATCATGG - Intergenic
1199106832 X:143878120-143878142 CTATATATGTAGAATTATAAAGG + Intergenic
1199432205 X:147774279-147774301 CTGTATTTGTGTAAGGATAAGGG - Intergenic
1199728485 X:150607554-150607576 ATGTATAGGGAAAAGGATAAAGG - Intronic
1200616348 Y:5384514-5384536 CTGTATGTTTTAGAGTATAAAGG + Intronic
1201309936 Y:12587932-12587954 CAATATATGTAAAAGTATGTAGG + Intergenic