ID: 1069268934

View in Genome Browser
Species Human (GRCh38)
Location 10:66499573-66499595
Sequence CAATTTTAATAGAGAACAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069268930_1069268934 6 Left 1069268930 10:66499544-66499566 CCTTGAACTCCTGGGACGACAGG 0: 1
1: 0
2: 1
3: 46
4: 553
Right 1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG No data
1069268926_1069268934 26 Left 1069268926 10:66499524-66499546 CCCTATGTAGCTCAGGCTAACCT 0: 1
1: 0
2: 7
3: 111
4: 1068
Right 1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG No data
1069268933_1069268934 -3 Left 1069268933 10:66499553-66499575 CCTGGGACGACAGGGAAAATCAA 0: 1
1: 0
2: 1
3: 11
4: 141
Right 1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG No data
1069268927_1069268934 25 Left 1069268927 10:66499525-66499547 CCTATGTAGCTCAGGCTAACCTT 0: 1
1: 0
2: 3
3: 66
4: 693
Right 1069268934 10:66499573-66499595 CAATTTTAATAGAGAACAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069268934 Original CRISPR CAATTTTAATAGAGAACAAT AGG Intronic
No off target data available for this crispr