ID: 1069269317

View in Genome Browser
Species Human (GRCh38)
Location 10:66505146-66505168
Sequence ATAAACAATAAGTAGACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069269317 Original CRISPR ATAAACAATAAGTAGACTGC AGG (reversed) Intronic
901609001 1:10482123-10482145 AAAAACAAAAAGTAGAATGGTGG - Intronic
902997247 1:20236107-20236129 AGAAACAATCAGTAGACTGATGG + Intergenic
903831836 1:26180129-26180151 AAAAACAAAAAAAAGACTGCTGG + Intronic
912571217 1:110624307-110624329 ATAAAAAAGAAATAGACTACTGG + Intronic
912900783 1:113645701-113645723 ATTAACAATGACTAGAATGCAGG - Intronic
915992384 1:160530647-160530669 AGAAACAATAAGTAGATTATAGG - Intergenic
917686723 1:177424036-177424058 ATAAACAGTAAGCATCCTGCCGG + Intergenic
918086845 1:181252763-181252785 AAATAAAATAAGTAGACTCCAGG - Intergenic
918885223 1:190184362-190184384 ATAAACAATAATGGGATTGCTGG - Intronic
920706506 1:208254889-208254911 ATACATACTAAGAAGACTGCCGG + Intergenic
920843287 1:209573055-209573077 AAAAACTAGAAGTAGACAGCCGG + Intergenic
921532551 1:216302864-216302886 ATAGACAACATGTAGACTGAAGG - Intronic
921682896 1:218055057-218055079 ATAAACAATAAGTAGAGGCCTGG - Intergenic
922772735 1:228196390-228196412 AAAAACAGGAAGTAGACTGATGG - Intergenic
922969168 1:229719888-229719910 ATAGACAAAAAGTAGAATGATGG - Intergenic
924249762 1:242120131-242120153 ATAAAGAAAAAGTAGACTGCTGG + Intronic
1063424925 10:5943441-5943463 ATAAAAAATAAGTAGCATGGAGG + Intronic
1064356806 10:14626286-14626308 ATAAACAATAAAAACAATGCTGG + Intronic
1065195693 10:23263111-23263133 ATAAACAACAGGTAAAGTGCTGG + Intergenic
1065696078 10:28380832-28380854 AGAAACAAAAAGTAGACTAAAGG - Intergenic
1066252306 10:33646504-33646526 ATAAACAATATGGAAACTGCTGG + Intergenic
1068070434 10:52187489-52187511 AAAAACAATGAGTAGGCTACAGG + Intronic
1068396379 10:56466823-56466845 ATAAAAAAAAAGAAAACTGCAGG + Intergenic
1068449754 10:57170933-57170955 ATACACAATAATAAGATTGCTGG - Intergenic
1068843041 10:61637616-61637638 AGAAACAATGAGTAGAATGGTGG - Intergenic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1071102627 10:82056843-82056865 ATAAACAATAATTAGACTACTGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1072827570 10:98623278-98623300 AGAGACAATAAGTAGACTAATGG + Intronic
1073237731 10:102032694-102032716 ATCAAAAATCAGAAGACTGCTGG - Intronic
1075363652 10:121863241-121863263 AAAAAAAAAAAGTAGACTTCAGG - Intronic
1075603830 10:123790134-123790156 ATAAAAAATAAATAGAGAGCAGG + Intronic
1078035835 11:7804210-7804232 ATAAAAAATACTTAGACTGGGGG - Intergenic
1078418983 11:11191946-11191968 TAAAAGAATAAATAGACTGCTGG + Intergenic
1078486982 11:11732331-11732353 ATAAACAATGAGTCAACTGGAGG + Intergenic
1078944258 11:16046019-16046041 ATAAACAATAAATAATTTGCTGG + Intronic
1079053976 11:17189275-17189297 GTAAAAAATAAGTAAACTTCAGG + Intronic
1081072191 11:38625034-38625056 ATAAACAATAAGATGTCTGCTGG - Intergenic
1083097190 11:60263699-60263721 AAACACAATAAGAAGACGGCAGG - Intergenic
1084478791 11:69404708-69404730 ATAAACAGAAAGTAGAATACAGG - Intergenic
1086022555 11:82248884-82248906 AGAAACAGAAAGTAGAATGCTGG + Intergenic
1088033211 11:105277538-105277560 AGAAATAATATATAGACTGCAGG - Intergenic
1088276352 11:108090500-108090522 AAAATAAATAAATAGACTGCAGG + Intronic
1090992354 11:131829696-131829718 ATAACCAATAATGAGATTGCTGG + Intronic
1093487680 12:19669440-19669462 AGAAACAAAAAGTAGAATGATGG - Intronic
1093916107 12:24803976-24803998 ATAAAGAATAAATAGTATGCAGG + Intergenic
1094860692 12:34462756-34462778 AAACAAAATAAGTAGACTCCAGG + Intergenic
1095146663 12:38738107-38738129 ATGAACAGTATGTAGACTGGTGG - Intronic
1095335210 12:41016275-41016297 AAAAACAATAGGTAGGGTGCGGG + Intronic
1095717231 12:45359476-45359498 AGAAACAGGAAGTAGACTGTTGG - Intronic
1095867448 12:46988124-46988146 ATAAACAATAATGGGATTGCTGG - Intergenic
1096198484 12:49664414-49664436 ATAAACAAAAAGAAGACAGAAGG + Intronic
1096894295 12:54804821-54804843 ATAACCAATAATAAGATTGCTGG + Intergenic
1097822071 12:64138146-64138168 AGAAACAAAAAGTAGAATGGTGG - Intronic
1099489120 12:83266752-83266774 CTAAACAATGGGTAGACAGCTGG - Intergenic
1100610575 12:96188891-96188913 AGAAACAAAAAGTAGAATGATGG + Intergenic
1101716172 12:107314888-107314910 ATGAACACTCAGTAGAATGCAGG - Intergenic
1102757239 12:115352106-115352128 ATAAACAGAAAGTAGAATGCTGG - Intergenic
1103358374 12:120338793-120338815 AGAAACAAGAAGTAGAATGGTGG - Intergenic
1106832089 13:33594701-33594723 ATAGACAGAAAGTAGATTGCTGG - Intergenic
1107189540 13:37562436-37562458 ATAAAGAATCATTAGACGGCCGG - Intergenic
1107220735 13:37976637-37976659 ATACACAGTAATGAGACTGCTGG - Intergenic
1108602293 13:52005181-52005203 ATAAAGAATAAAAAGGCTGCTGG - Intronic
1108812334 13:54243249-54243271 AGAAACAATAAGTAAACTAATGG + Intergenic
1110149548 13:72233935-72233957 ATAAAGAATTATTTGACTGCTGG - Intergenic
1110525832 13:76535779-76535801 ATAACCAATAATGAGATTGCTGG - Intergenic
1111439948 13:88268436-88268458 ATACACAATAATAAGATTGCTGG - Intergenic
1111656857 13:91164697-91164719 ATAAAAAGAAAGTAGACAGCGGG - Intergenic
1113986477 13:114320496-114320518 ATAAGCACTCAGAAGACTGCTGG - Intronic
1114339188 14:21725041-21725063 AGAAACAATAAATAGAGTGAAGG + Intergenic
1115581294 14:34761284-34761306 ATAAAAAATAAAAAGACAGCTGG + Intronic
1116558458 14:46344410-46344432 ACATACAATATGTAGACTGGGGG + Intergenic
1116673736 14:47878040-47878062 ATAACCAATAATGAGATTGCTGG - Intergenic
1116756610 14:48956803-48956825 AGAAACACAAAGTAGAATGCTGG + Intergenic
1116915058 14:50517015-50517037 GTAAATAATAACTAGACTGGTGG - Intronic
1117112067 14:52468056-52468078 ATAAACAGAAAGTAGAGTGGTGG + Intronic
1117501839 14:56360107-56360129 ATAACCAATAAATGGATTGCTGG + Intergenic
1118120519 14:62835769-62835791 AGAAACAAAAATTAGACTGAAGG + Intronic
1118627420 14:67672417-67672439 AAGAAAAAAAAGTAGACTGCAGG - Intronic
1118630071 14:67694901-67694923 AGAACCAATAAGCAGGCTGCCGG + Intronic
1118911445 14:70065260-70065282 ATCAACAATATGGACACTGCAGG - Intronic
1119816622 14:77574801-77574823 AAAGACAAAAAGTAGACTACTGG + Intronic
1120163673 14:81171445-81171467 AGAAACAAAAAGTAGAATGGTGG - Intergenic
1122705951 14:103621628-103621650 ATAAAAAATAAATAAACTGCCGG + Intronic
1124434924 15:29639464-29639486 ATAAAAAATAAGTCAAATGCTGG + Intergenic
1125252550 15:37722180-37722202 TTAATCAATAAGTATTCTGCAGG - Intergenic
1126502437 15:49360910-49360932 GTAAACACTGAGTAGACTGGAGG - Intronic
1126722698 15:51598850-51598872 ATAATTAATAAGTATACTGTGGG + Intronic
1126806682 15:52357514-52357536 ATAAACAACTAGTTGATTGCTGG + Intronic
1127054192 15:55114895-55114917 ATACCCAATAATGAGACTGCTGG + Intergenic
1128971662 15:72112898-72112920 ATATACAAAAAGTACACAGCTGG - Intronic
1129585451 15:76858982-76859004 ATACTCAGTAATTAGACTGCTGG + Intronic
1129948701 15:79564718-79564740 TTAAAAAATAAGAAGACTGAGGG + Intergenic
1132169993 15:99640982-99641004 ATAAACATCAACTAGACTGGTGG - Intronic
1132780623 16:1622742-1622764 AAAAAAAAAAAGTAGACTGCCGG - Intronic
1133603541 16:7363818-7363840 ATAAACATCAAGAAGACTGACGG - Intronic
1135997245 16:27259810-27259832 AAGAGCAACAAGTAGACTGCCGG + Intronic
1136562333 16:31047356-31047378 AAAAACAAAAATTAGCCTGCTGG - Intergenic
1138238333 16:55404921-55404943 AGAAACAATAAGTAGTGTGCTGG + Intronic
1138322607 16:56129374-56129396 AGAAACAAAAAGTAGAATGGTGG + Intergenic
1139155679 16:64438828-64438850 AGAAACAAAAAGTAGACTAATGG + Intergenic
1139194254 16:64900074-64900096 AAAAACAATAAGTAGTCTAGAGG - Intergenic
1139610950 16:68058147-68058169 ATGAAGAAGAAGCAGACTGCAGG + Intronic
1139980465 16:70854174-70854196 AGAAATAATAGGAAGACTGCTGG - Intronic
1140186041 16:72773267-72773289 ATAAACCAAAAGTAGACTGTGGG - Intergenic
1140438474 16:74968092-74968114 AGAAACAAAAAGTAGAATGGAGG + Intronic
1140578062 16:76196042-76196064 AAAAACAATAAATAGTCAGCAGG - Intergenic
1141059644 16:80853833-80853855 AGAAACAAAAAGTAGATTGGTGG - Intergenic
1141353839 16:83324432-83324454 AGAGACAAGAAGTAGACTGGTGG - Intronic
1142118145 16:88371287-88371309 ATAAACAATTAGGAGAATCCAGG + Intergenic
1145043898 17:19597100-19597122 ATGAACAATCAGGAGGCTGCTGG + Intergenic
1147406527 17:40216416-40216438 AGAAAAAATAAAAAGACTGCAGG + Intergenic
1148236294 17:45971460-45971482 ATTAACAACAAGTAGACACCTGG - Intronic
1148257090 17:46144377-46144399 ATATGCAATTAGTAGACTGCTGG - Intronic
1150968027 17:69994272-69994294 AGAAACAAAAAGTAGAATGGTGG + Intergenic
1153033058 18:733178-733200 ATAAAAAATAAGTTGGCTGTGGG + Intronic
1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG + Intronic
1156139590 18:34090729-34090751 TTAAGCAATAAGAAGCCTGCTGG + Intronic
1156770628 18:40717932-40717954 AGAAACAACAAGTAGACAGGAGG - Intergenic
1159112039 18:64070521-64070543 ATAAAAAATAAGTCACCTGCAGG + Intergenic
1162672280 19:12267015-12267037 AGAAAAAATGAGTAGACTGAGGG - Intronic
1164377923 19:27705732-27705754 AAAAAAAATAAGTAGCCTCCAGG + Intergenic
1164514876 19:28925270-28925292 TTAAAAAATAAGTAGAATACAGG - Intergenic
1168617227 19:57848396-57848418 ATAAAAAATAAATAAATTGCTGG - Intronic
924960739 2:32189-32211 AAAAACAAAGAGTAGAATGCTGG + Intergenic
925391648 2:3499124-3499146 ATAAATACTAAGTAGAAGGCCGG - Intronic
927473122 2:23391082-23391104 ATAAACAGGAAGTAGAATGGCGG - Intronic
928199466 2:29238178-29238200 ATAAAAAATAATTAAACTGCCGG - Intronic
931552730 2:63464844-63464866 AGAAACAGAAAGTAGAATGCTGG + Intronic
934565376 2:95337206-95337228 ATAAAGATGAAGTAAACTGCGGG + Intronic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935720862 2:105977819-105977841 ATAAGCAATAAGAAGACACCAGG - Intergenic
937942352 2:127295851-127295873 ATAAGCAATAAGGAGAAAGCAGG - Intergenic
939082220 2:137675870-137675892 AGAAACAAGAAGTGTACTGCAGG + Intronic
940375334 2:152951679-152951701 GAAAGCAATAAATAGACTGCAGG + Intergenic
940850925 2:158687494-158687516 AGAGACAAGAAGGAGACTGCTGG - Intergenic
942843796 2:180398450-180398472 ATGAACAATAACTAGACGCCAGG + Intergenic
943904957 2:193487224-193487246 ACAAAAAATAAGTTGAATGCTGG - Intergenic
943916508 2:193641671-193641693 AAAATCAATAAGGAGACAGCAGG - Intergenic
945240166 2:207669232-207669254 AGAAACAAAAAGTAGAATGGTGG - Intergenic
945975388 2:216266487-216266509 ATAAACAATGACTTGACTGAGGG - Intronic
946516205 2:220413848-220413870 ATAAATAATCAGTAAACTGTGGG - Intergenic
946628385 2:221639946-221639968 ATGAAGAATGAGTAGACTGGTGG - Intergenic
947097914 2:226587372-226587394 ATAAAAAATCAGTTGACTGTAGG + Intergenic
947317324 2:228874969-228874991 ATAAATAAAAACTAGACTGAAGG - Intronic
1168945300 20:1749690-1749712 ATACCCAATAATGAGACTGCTGG - Intergenic
1169422043 20:5468646-5468668 AAAGACAAAAAGTAGAATGCTGG + Intergenic
1173269771 20:41522492-41522514 ATAACTAATAAGTAATCTGCAGG - Intronic
1173794420 20:45849207-45849229 ATAAACAGTAAACAGGCTGCAGG - Intronic
1174042090 20:47707283-47707305 ATAAAAAATAATAAAACTGCCGG - Intronic
1175702424 20:61149482-61149504 ACAAACAAAAAGGAGACTGATGG + Intergenic
1177560714 21:22748418-22748440 AAAAAGAATAAGTAGACTTTAGG + Intergenic
1177718220 21:24867883-24867905 AGAAACAATGAGTAGAATGGTGG + Intergenic
1178162263 21:29932298-29932320 CTAAATAATAAGTAAACTACTGG - Intronic
1178285229 21:31320262-31320284 ATAAACAGAAAGTAGAATGGAGG + Intronic
1178663605 21:34527226-34527248 ATAAACAGCAATTAGACTGTAGG + Intronic
1178798748 21:35771611-35771633 CTAAACCATAAGTAGATTTCTGG - Intronic
1180566537 22:16672093-16672115 GTAAACAATATGCAGACTGAAGG - Intergenic
1182954635 22:34410784-34410806 ATAAGCAATAACCAAACTGCTGG - Intergenic
1184386467 22:44178975-44178997 ATAAAAAATAAATAAATTGCAGG - Intronic
1184712506 22:46261188-46261210 ATATACAGTAAGTAACCTGCAGG + Exonic
1185305232 22:50111866-50111888 ATCAAAAATAAGCAGACTGATGG - Intronic
949163013 3:904336-904358 AAAAAAAATAAATAAACTGCAGG + Intergenic
949385166 3:3493740-3493762 ATAAACAATAGTTGGACTGCTGG - Intergenic
950019433 3:9776687-9776709 AAGAGCAATAAGAAGACTGCAGG - Intronic
950157628 3:10735614-10735636 ATAGACAATAAGTTAACTGAAGG + Intergenic
950648954 3:14395389-14395411 ATAAATAATAAATAGAAGGCCGG + Intergenic
952213161 3:31249842-31249864 ATAAACAATTGCTAGACTGAAGG + Intergenic
956418236 3:69056489-69056511 ATATATAATAAGTAGAGTTCTGG + Intronic
957182789 3:76902037-76902059 ATAAATATTAAGTAGACTTTTGG + Intronic
958598255 3:96258763-96258785 ATAACCAATAATTGGATTGCTGG + Intergenic
959437603 3:106335858-106335880 ATAAACATTTAGAACACTGCAGG + Intergenic
959484779 3:106914115-106914137 ATACACACTAAGAAGACTGAGGG + Intergenic
960407492 3:117279547-117279569 ATAAGCAATTTGTAGACTGCAGG - Intergenic
961617122 3:128191648-128191670 ATAAACAAAAAGTAGAATGGTGG - Intronic
962560702 3:136603542-136603564 ATAAATACTAAGTATTCTGCAGG - Intronic
963709116 3:148726200-148726222 AAAAAAAATCAGTAGACTGCAGG - Intronic
964206282 3:154178427-154178449 AGAAACAGAAAGTAGACTGGTGG - Intronic
964785677 3:160393480-160393502 AGAAACAAAAAGTAGAATGATGG + Intronic
966471823 3:180298233-180298255 ATAAACAAAAAGTAGTCTCTTGG - Intergenic
966600467 3:181770167-181770189 ATAAACAATAAGAAAAGGGCCGG + Intergenic
969138050 4:5046969-5046991 ATACCCAATAATTTGACTGCTGG - Intergenic
970265014 4:14272824-14272846 AAAAACAATAAGTATACTGATGG + Intergenic
970556426 4:17238005-17238027 AGAAACAAAAAGTAGAATGGTGG + Intergenic
970609959 4:17715968-17715990 ATAAGCAAAAAGCAGACTTCAGG - Intronic
970626797 4:17894817-17894839 CTAAACAATTATTAGACCGCTGG - Intronic
970703917 4:18776783-18776805 ATATCCAATAATGAGACTGCTGG - Intergenic
971675882 4:29628821-29628843 ATAAACTATAAACAGAATGCAGG + Intergenic
971688941 4:29808335-29808357 ATCAAAAATATTTAGACTGCTGG - Intergenic
971997056 4:33978478-33978500 ATAAGCAATCGGTAGAATGCTGG + Intergenic
972320389 4:37968322-37968344 AGAAATACTAAGAAGACTGCAGG - Intronic
972917702 4:43901673-43901695 ATAGCCAATAAGCAGACTGGGGG - Intergenic
975488819 4:74966364-74966386 ATAACCAATGAGTAGAGTGAGGG + Intronic
977764651 4:100782676-100782698 AGAAACAATAAGAAGGCTGCTGG - Intronic
979178844 4:117700221-117700243 AGAAACAATGAGTATATTGCAGG + Intergenic
979511791 4:121562553-121562575 ATACACAATAATGAGATTGCTGG + Intergenic
979902619 4:126242103-126242125 ATAATCAAGAAGAAGCCTGCAGG + Intergenic
979949139 4:126870285-126870307 AGAGACAAAAAGTAGAATGCTGG + Intergenic
981705190 4:147651783-147651805 AGAAACAGAAAGTAGATTGCTGG + Intronic
982377835 4:154714162-154714184 ATAAACAAGAATTAGAAGGCAGG + Intronic
984227108 4:177048382-177048404 ATAAAAAATAGGCAAACTGCCGG + Intergenic
985208788 4:187570019-187570041 ATTAACAATAAATAAACCGCTGG + Intergenic
985807230 5:2055025-2055047 GTCAAAAATAAGTAGACTGTGGG - Intergenic
986520968 5:8617658-8617680 ATACCCAATAACAAGACTGCTGG - Intergenic
986776981 5:11024876-11024898 ATAGATAATAAGTAGATGGCAGG + Intronic
986893846 5:12341480-12341502 ATAAACAATAATCAGACTTCTGG - Intergenic
986970880 5:13335101-13335123 ATACACAATAATGAGATTGCTGG + Intergenic
987026199 5:13929294-13929316 AGAGACAAAAAGTAGAATGCGGG + Intronic
987788346 5:22531665-22531687 AAAAATAATATGTAGATTGCAGG + Intronic
988446856 5:31296201-31296223 ATAACCAGTAAGCATACTGCTGG - Intronic
989455536 5:41639242-41639264 ATAAAAAATAAGTGGACTAATGG - Intergenic
989750859 5:44891543-44891565 ATAAAAAATGAGTTCACTGCAGG + Intergenic
990371075 5:55119051-55119073 ATAATCAATAAGTAAACCTCAGG + Intronic
990792266 5:59495609-59495631 ATAAAGCATTAGAAGACTGCAGG + Intronic
991627527 5:68619487-68619509 ATAAAAAATGAGAAGACTGGGGG - Intergenic
992718517 5:79535276-79535298 AAAAAAAATAAATACACTGCTGG - Intergenic
992952053 5:81868880-81868902 GAAATCAATAAGTAGCCTGCTGG - Intergenic
993021044 5:82591338-82591360 AATAACAATAAGAATACTGCAGG - Intergenic
993782329 5:92082744-92082766 ATAAAAGACAAGTAGCCTGCGGG + Intergenic
993942853 5:94081925-94081947 AGAAGCAAGAAGTAGACTTCAGG + Intronic
994438547 5:99770025-99770047 ATACCCAATAAGGAGATTGCTGG - Intergenic
995287808 5:110411624-110411646 AGAAACAAAAAGTAGAATGGTGG - Intronic
996079078 5:119235008-119235030 ATGAATAGTAAGTTGACTGCCGG - Intronic
996380304 5:122856482-122856504 ATAACCAATAATTGGAATGCTGG + Intronic
996449184 5:123599185-123599207 ACAAACATTAAGGACACTGCTGG + Intronic
996564832 5:124868762-124868784 ATAATTAATAAGTAAACTGTGGG + Intergenic
997850101 5:137324579-137324601 AAAAACAAAAAGTAGAATGGTGG + Intronic
998857479 5:146407389-146407411 ATAAATAATAAGTAGCTTGTGGG + Intergenic
1000473955 5:161681594-161681616 ATATACAATAAGTAAAAAGCAGG - Intronic
1004490850 6:16113828-16113850 AGAAACAAAAAGTAGAATGATGG - Intergenic
1005577183 6:27200855-27200877 ATAATCACCAAGTAGAATGCAGG - Intergenic
1006059324 6:31408603-31408625 AGAAACAAAAAGTAGAATGGTGG - Intronic
1006071807 6:31503484-31503506 AGAAACAAAAAGTAGAATGATGG - Intronic
1008930645 6:56935629-56935651 ATAAAGAATAATGAGATTGCCGG + Intronic
1009028853 6:58032948-58032970 ATAAAGAATAAGTTGACTCTAGG - Intergenic
1009768695 6:68117317-68117339 ATAAAAAATAAGTAGAAAGGTGG - Intergenic
1010377535 6:75189156-75189178 CTAAACATTAAGTATACTGTAGG + Intronic
1011006517 6:82651492-82651514 AAAAAGAAGAAGTAGACTGTGGG + Intergenic
1011350267 6:86415297-86415319 ATAAACCATATACAGACTGCTGG - Intergenic
1013837828 6:114353575-114353597 ATAAACAAAATGTCTACTGCAGG + Intergenic
1013975454 6:116072861-116072883 AGAAATAGTAAGTAAACTGCTGG + Intergenic
1015045514 6:128771156-128771178 ATAAACAATAATGGGATTGCTGG - Intergenic
1015474717 6:133647643-133647665 ATAAACAATAAGTATAGTCCTGG - Intergenic
1017142361 6:151202935-151202957 AGAAACAAAAAGTAGAATGGTGG + Intergenic
1017850265 6:158299239-158299261 ATATAAAATAAGTAGCCTCCAGG + Intronic
1018375415 6:163206192-163206214 ATACCCAATAAGGAGATTGCTGG - Intronic
1019755545 7:2766149-2766171 AGAAACAAAAAGTAGAATGCTGG - Intronic
1021686980 7:23195684-23195706 TTAAACATTAAGTAGAGTGTAGG + Intronic
1022683125 7:32568677-32568699 ATAAATTACAAGTAGAATGCTGG + Intronic
1022949795 7:35326764-35326786 ATATACTAGAAGTAGACTTCTGG - Intergenic
1023299770 7:38757763-38757785 GGAAACAAGAAGTATACTGCAGG - Intronic
1024340704 7:48255820-48255842 ATACACAATAATGGGACTGCTGG + Intronic
1024838152 7:53548936-53548958 ATTGACATTAAGTGGACTGCTGG + Intergenic
1026174834 7:67987485-67987507 ATAACCAATAATAAGATTGCTGG + Intergenic
1026234606 7:68515808-68515830 AGAAACAGTGAGTAGAATGCTGG + Intergenic
1026397853 7:69976185-69976207 AGAAACAGAAAGTAGACTGGTGG - Intronic
1027466154 7:78516843-78516865 ATAAACAATACCAAGACTGGGGG + Intronic
1027999671 7:85477299-85477321 AGAAACAAAAAGTAGAATGGTGG - Intergenic
1030748182 7:113194521-113194543 ATAAAAAATAAGTTAACTGTAGG + Intergenic
1034104146 7:148476281-148476303 ATAAAAAATAAATAAACTCCTGG + Intergenic
1034554753 7:151842897-151842919 ATAGAAAACAAGTAAACTGCAGG + Intronic
1037291426 8:17353247-17353269 AGAAACAAAAAGTAGAATGATGG + Intronic
1040357058 8:46628867-46628889 ATACCCAATAAGGAGATTGCTGG - Intergenic
1040878806 8:52181493-52181515 AGAAGCAATAATTAGACAGCTGG + Intronic
1041104967 8:54432990-54433012 AGAGACAAAAAGTAGAATGCTGG + Intergenic
1042797055 8:72675850-72675872 ATAAACAAAAATCAGACTGCAGG - Intronic
1042832320 8:73044730-73044752 ATAAACAGAAAGTAGAATGATGG - Intronic
1045015604 8:97999027-97999049 ATAGACAAAAAGTAGATTGGTGG - Intronic
1045987827 8:108269902-108269924 AGAAACAAAAAGTAGAATGGTGG - Intronic
1046770650 8:118113135-118113157 ATAAACAATCACTAAACAGCCGG - Intergenic
1047707410 8:127513637-127513659 ATGAACAATAAGAACACTACTGG + Intergenic
1048071300 8:131024061-131024083 AGAAACAAGAACTACACTGCAGG - Intronic
1048240292 8:132734557-132734579 ATAAAAAATATGTAGAATACTGG + Intronic
1050328933 9:4525409-4525431 AGAAAAAATAAGTAGCCTGTAGG + Intronic
1050942679 9:11480258-11480280 ATACACAGTAATGAGACTGCTGG + Intergenic
1051098668 9:13495890-13495912 GTCAACAATAATTAGACTACTGG + Intergenic
1051806732 9:21002517-21002539 AGAGACAAAAAGTAGACTGGTGG + Exonic
1052680460 9:31685116-31685138 ATAAACAGTAATGAGATTGCTGG - Intergenic
1058109901 9:101020895-101020917 ATAAACAGAAAGTAGAATGGTGG - Intergenic
1058223250 9:102328290-102328312 ATACCCAATAAGAAGATTGCTGG - Intergenic
1058281597 9:103123151-103123173 ATAAACAATAACTAGTCCTCAGG + Intergenic
1061058727 9:128239750-128239772 ATGAACAAGAAGAAGACTTCAGG + Exonic
1186121997 X:6373418-6373440 TAATACAATAAGTAAACTGCGGG - Intergenic
1187517039 X:19981829-19981851 AGAAATAAAAAGTAGACTGGTGG + Intergenic
1188097300 X:26040909-26040931 ATAAAAAAAAATTAGACAGCAGG + Intergenic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1188813514 X:34682679-34682701 AGAAACAGAAAGTAGAATGCTGG - Intergenic
1189042033 X:37552853-37552875 AAAAAAATTAAGTAGACTTCTGG + Intronic
1189120646 X:38390804-38390826 ATAAAAAACAAGTAGTGTGCTGG - Intronic
1190855561 X:54291015-54291037 ATAAACAATAAGTTGTTGGCCGG + Intronic
1192928375 X:75779956-75779978 AGAAAGAAGAAGGAGACTGCAGG + Intergenic
1193826841 X:86236734-86236756 ATGAACAATATGTGGACTGCAGG + Intronic
1194101592 X:89712057-89712079 ATATCCAATAATGAGACTGCTGG + Intergenic
1194609557 X:96024453-96024475 ATAAACAAAAAGTAGAATGGTGG + Intergenic
1195716495 X:107823719-107823741 AGAAACAGAAAGTAGAATGCTGG - Intergenic
1195888377 X:109666378-109666400 AGAAACAGTAAGAAGACTGGTGG + Intronic
1196142455 X:112279059-112279081 AAAAACAATAAGAAAACTGAAGG + Intergenic
1197025616 X:121745482-121745504 ATAATCAATAATGAGATTGCTGG + Intergenic
1197162576 X:123340464-123340486 GTAAATAATTAGTAGACTGAGGG + Intronic
1197288844 X:124630108-124630130 ATGAACAAAAAGAAGACTGTTGG + Intronic
1197796908 X:130307455-130307477 ATAAAAAATAAACAGACTGGTGG - Intergenic
1198433327 X:136589714-136589736 ATAAACAAGAAATAAACTCCTGG - Intergenic
1198665688 X:139019817-139019839 ATAAACAGTAACTATAATGCTGG + Intronic
1199433196 X:147783955-147783977 AGAAACAAAAAGTAGACTACTGG + Intergenic