ID: 1069269337 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:66505451-66505473 |
Sequence | ATGTAATCACAGATGACTCA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1069269335_1069269337 | 3 | Left | 1069269335 | 10:66505425-66505447 | CCTGAACAATATACTGTAACATG | 0: 1 1: 0 2: 0 3: 21 4: 219 |
||
Right | 1069269337 | 10:66505451-66505473 | ATGTAATCACAGATGACTCAGGG | No data | ||||
1069269334_1069269337 | 4 | Left | 1069269334 | 10:66505424-66505446 | CCCTGAACAATATACTGTAACAT | 0: 1 1: 0 2: 4 3: 39 4: 402 |
||
Right | 1069269337 | 10:66505451-66505473 | ATGTAATCACAGATGACTCAGGG | No data | ||||
1069269333_1069269337 | 14 | Left | 1069269333 | 10:66505414-66505436 | CCACAATGATCCCTGAACAATAT | 0: 1 1: 0 2: 3 3: 16 4: 226 |
||
Right | 1069269337 | 10:66505451-66505473 | ATGTAATCACAGATGACTCAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1069269337 | Original CRISPR | ATGTAATCACAGATGACTCA GGG | Intronic | ||
No off target data available for this crispr |