ID: 1069269337

View in Genome Browser
Species Human (GRCh38)
Location 10:66505451-66505473
Sequence ATGTAATCACAGATGACTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069269335_1069269337 3 Left 1069269335 10:66505425-66505447 CCTGAACAATATACTGTAACATG 0: 1
1: 0
2: 0
3: 21
4: 219
Right 1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG No data
1069269334_1069269337 4 Left 1069269334 10:66505424-66505446 CCCTGAACAATATACTGTAACAT 0: 1
1: 0
2: 4
3: 39
4: 402
Right 1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG No data
1069269333_1069269337 14 Left 1069269333 10:66505414-66505436 CCACAATGATCCCTGAACAATAT 0: 1
1: 0
2: 3
3: 16
4: 226
Right 1069269337 10:66505451-66505473 ATGTAATCACAGATGACTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069269337 Original CRISPR ATGTAATCACAGATGACTCA GGG Intronic
No off target data available for this crispr