ID: 1069270533

View in Genome Browser
Species Human (GRCh38)
Location 10:66521488-66521510
Sequence GAATGCCCAGTGATTTCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069270532_1069270533 -3 Left 1069270532 10:66521468-66521490 CCAAATTAGGACTGTAAGTTGAA 0: 1
1: 1
2: 16
3: 87
4: 254
Right 1069270533 10:66521488-66521510 GAATGCCCAGTGATTTCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069270533 Original CRISPR GAATGCCCAGTGATTTCCCA TGG Intronic
No off target data available for this crispr