ID: 1069270628

View in Genome Browser
Species Human (GRCh38)
Location 10:66522612-66522634
Sequence GACCCACAGCTCCACAGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11587
Summary {0: 1, 1: 6, 2: 325, 3: 3685, 4: 7570}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069270628_1069270631 0 Left 1069270628 10:66522612-66522634 CCAGCCCTGTGGAGCTGTGGGTC 0: 1
1: 6
2: 325
3: 3685
4: 7570
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069270628 Original CRISPR GACCCACAGCTCCACAGGGC TGG (reversed) Intronic
Too many off-targets to display for this crispr