ID: 1069270631

View in Genome Browser
Species Human (GRCh38)
Location 10:66522635-66522657
Sequence AATTAAACCTCTTTCCTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069270627_1069270631 1 Left 1069270627 10:66522611-66522633 CCCAGCCCTGTGGAGCTGTGGGT 0: 1
1: 5
2: 344
3: 4026
4: 7811
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data
1069270629_1069270631 -4 Left 1069270629 10:66522616-66522638 CCCTGTGGAGCTGTGGGTCAATT 0: 2
1: 90
2: 2112
3: 4797
4: 8316
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data
1069270628_1069270631 0 Left 1069270628 10:66522612-66522634 CCAGCCCTGTGGAGCTGTGGGTC 0: 1
1: 6
2: 325
3: 3685
4: 7570
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data
1069270621_1069270631 28 Left 1069270621 10:66522584-66522606 CCATGGTTGTGAGTTTTCTGAGG 0: 1
1: 21
2: 762
3: 6989
4: 8570
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data
1069270630_1069270631 -5 Left 1069270630 10:66522617-66522639 CCTGTGGAGCTGTGGGTCAATTA 0: 1
1: 28
2: 654
3: 1252
4: 2064
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data
1069270625_1069270631 2 Left 1069270625 10:66522610-66522632 CCCCAGCCCTGTGGAGCTGTGGG 0: 1
1: 6
2: 325
3: 3864
4: 7777
Right 1069270631 10:66522635-66522657 AATTAAACCTCTTTCCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069270631 Original CRISPR AATTAAACCTCTTTCCTTTA TGG Intronic
No off target data available for this crispr