ID: 1069271125

View in Genome Browser
Species Human (GRCh38)
Location 10:66529080-66529102
Sequence ACTTTAGGCTCCACACAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069271122_1069271125 -6 Left 1069271122 10:66529063-66529085 CCCTCAAAACTCTGTATACTTTA No data
Right 1069271125 10:66529080-66529102 ACTTTAGGCTCCACACAGCCTGG No data
1069271123_1069271125 -7 Left 1069271123 10:66529064-66529086 CCTCAAAACTCTGTATACTTTAG No data
Right 1069271125 10:66529080-66529102 ACTTTAGGCTCCACACAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069271125 Original CRISPR ACTTTAGGCTCCACACAGCC TGG Intronic