ID: 1069275741

View in Genome Browser
Species Human (GRCh38)
Location 10:66588277-66588299
Sequence TTCCATCTGGTTCACAGTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 4, 1: 1, 2: 4, 3: 30, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069275738_1069275741 7 Left 1069275738 10:66588247-66588269 CCCTCTCACACACTCTGGAGACT No data
Right 1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG 0: 4
1: 1
2: 4
3: 30
4: 188
1069275736_1069275741 9 Left 1069275736 10:66588245-66588267 CCCCCTCTCACACACTCTGGAGA 0: 1
1: 0
2: 1
3: 20
4: 293
Right 1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG 0: 4
1: 1
2: 4
3: 30
4: 188
1069275739_1069275741 6 Left 1069275739 10:66588248-66588270 CCTCTCACACACTCTGGAGACTC 0: 1
1: 0
2: 5
3: 37
4: 263
Right 1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG 0: 4
1: 1
2: 4
3: 30
4: 188
1069275737_1069275741 8 Left 1069275737 10:66588246-66588268 CCCCTCTCACACACTCTGGAGAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG 0: 4
1: 1
2: 4
3: 30
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069275741 Original CRISPR TTCCATCTGGTTCACAGTGT AGG Intronic
903666353 1:25009884-25009906 TTGCAGCTGCTACACAGTGTAGG - Intergenic
903772923 1:25775368-25775390 TTCCATCTGCCACTCAGTGTGGG + Intronic
904489691 1:30850757-30850779 TTGCACCTGCTTCACAGGGTTGG - Intergenic
905987391 1:42299133-42299155 GTCCATCTGGTCTACAGTTTAGG + Intronic
906576777 1:46898358-46898380 CTCCATCTGGTCCCTAGTGTCGG - Intergenic
906595141 1:47069227-47069249 CTCCATCTGGTCCCTAGTGTGGG + Intronic
907413258 1:54297137-54297159 TTCCTTCTGGTTCCCACTGGAGG - Intronic
908892030 1:68859332-68859354 TTCCTCCTGGCTCACAGTGTAGG + Intergenic
909031144 1:70542349-70542371 TTCAATCTGCTTCACAGTTAAGG + Intergenic
910264585 1:85324923-85324945 TTCCTTCTGTTTGAAAGTGTGGG - Intronic
915057164 1:153143735-153143757 TTCTGCCTGGCTCACAGTGTAGG + Intergenic
915801319 1:158795813-158795835 TTCTGTCTGGTTCACAGTGTAGG + Intergenic
918371484 1:183866014-183866036 TTCCATCTTCTTCACAGTTTGGG - Exonic
919483659 1:198120008-198120030 TTCGATTTGGTGCACAGTTTGGG - Intergenic
920964954 1:210693893-210693915 TTCCATCTGGTTCCTAGGATGGG - Intronic
922464981 1:225840309-225840331 ATCCCTCTGCTTCTCAGTGTAGG - Intronic
923401177 1:233616190-233616212 TTACAACTGGGTCACAATGTTGG + Intronic
1063048644 10:2420510-2420532 TTCCATCTGGTTTCCCCTGTAGG - Intergenic
1063335006 10:5203583-5203605 TTTCATCTGTCTCACAGTGTTGG + Intronic
1067271524 10:44795726-44795748 TTCCAGCTGTTTCACATGGTGGG + Intergenic
1068476560 10:57534132-57534154 TTCCATCTATTTCACAGAATAGG + Intergenic
1068562758 10:58534356-58534378 TTCAGTCTGGTTCACAGTATAGG - Intronic
1069275741 10:66588277-66588299 TTCCATCTGGTTCACAGTGTAGG + Intronic
1069718250 10:70534296-70534318 TTCCTTCTGAATCACATTGTGGG - Intronic
1070438396 10:76416039-76416061 TTCCATATGATACAAAGTGTAGG - Intronic
1070757108 10:79000145-79000167 TTGCATCTGGTTCACTATTTTGG + Intergenic
1071262044 10:83929126-83929148 CTCCTTCTGGCTCACAGGGTTGG + Intergenic
1071881187 10:89899289-89899311 TTCTTCCTGGCTCACAGTGTAGG + Intergenic
1072284725 10:93903222-93903244 TTCCACCTGATTTACAGTATTGG + Intronic
1073682315 10:105717765-105717787 TTCCATCTAGTTCACAGTAGTGG + Intergenic
1074467114 10:113692941-113692963 TTCTACCTGGTTCACAGTATAGG + Intronic
1074925877 10:118070230-118070252 TTACATGTGGTTCATTGTGTAGG - Intergenic
1076112649 10:127872688-127872710 TTCCATCTGCTTCGCGGTATAGG + Intergenic
1077853134 11:6095428-6095450 TTCTGCCTGGATCACAGTGTAGG - Intergenic
1079533247 11:21480490-21480512 TTCATTCAGCTTCACAGTGTCGG + Intronic
1079763422 11:24358233-24358255 TTCTGTCTGGTTCACAGCGTAGG + Intergenic
1079881461 11:25932522-25932544 TTCCATGTGGCTCACAGTGGTGG - Intergenic
1080952133 11:37046187-37046209 TTCCATTTTGTTCAGAGTGGTGG - Intergenic
1081257834 11:40919232-40919254 TTCCAGCTGTATCACAGTGTAGG + Intronic
1081962502 11:47148659-47148681 TTCTATCTGGTTTAAAGTGCTGG - Intronic
1087364686 11:97203106-97203128 TTCCACCTGGCTCACAGTGTAGG + Intergenic
1087641047 11:100753864-100753886 TTCCACCTGGCTCTCAGTGTAGG + Intronic
1087644274 11:100789167-100789189 TTCCATTTGGATGACAGTGTAGG - Intronic
1087972573 11:104502705-104502727 TTACATTTGGTTGAAAGTGTTGG - Intergenic
1092458286 12:8664485-8664507 TTCCATCTGCTCCCCAGTGAAGG + Intergenic
1093267172 12:17016930-17016952 TTCCACCTGTATCACAGTGTAGG + Intergenic
1095082705 12:38025869-38025891 TTGCTTTTGGTTCACAGTTTGGG + Intergenic
1095535322 12:43239242-43239264 TTCCATATGGTTCCCAGGTTGGG + Intergenic
1095554188 12:43481908-43481930 TTCCGTCTGGTTCATGATGTAGG - Intronic
1095785955 12:46109400-46109422 TTCTGCCTGGTTCACAGTGCAGG - Intergenic
1096833177 12:54330473-54330495 TTCCCTCTTCTTCACAGTGGTGG + Intronic
1097987196 12:65796370-65796392 TTCCTGATGGTTCACAGTGTTGG + Intergenic
1098355299 12:69607032-69607054 TTGCTTCTGGTTCACTGTGTTGG + Intergenic
1100102070 12:91121076-91121098 TTTTATCTTGTTCACTGTGTTGG - Intergenic
1101773011 12:107768815-107768837 TTCCATCTGTTTCTAGGTGTTGG - Intergenic
1101840362 12:108323671-108323693 TGCCATCTGGTCCAATGTGTAGG + Intronic
1102546390 12:113659758-113659780 TTCCTTCTGATTCACGGTTTTGG - Intergenic
1103060349 12:117853669-117853691 TGCCATCTGCTTCTCACTGTGGG + Intronic
1104465934 12:128990570-128990592 TTCCATCTTGTGCAGAGTGTAGG + Intergenic
1104741150 12:131175791-131175813 TTCCACCTGGCTCATGGTGTAGG - Intergenic
1104793417 12:131498799-131498821 TTCCATTTGGGCCACAGTGATGG - Intergenic
1105586360 13:21748104-21748126 ATCCATAAGGTTCACAGTGAGGG + Intergenic
1106202148 13:27548030-27548052 CTCCATCTGGGGCACAGTTTGGG + Exonic
1107907880 13:45078331-45078353 TTCCATATGATCCACAGTTTGGG - Intergenic
1110209497 13:72954717-72954739 TTCCATCTGGTTCACAGTGTAGG + Intronic
1110599174 13:77351693-77351715 TTCCTTCTTCTTCAAAGTGTAGG - Intergenic
1110946259 13:81422818-81422840 TTCCTTGTGTTTCACAGTTTAGG + Intergenic
1111754330 13:92373851-92373873 TTTCATCTGATTAACAGTGTAGG + Intronic
1112390265 13:98977233-98977255 TATCAGCTGGTTCACAGTTTAGG + Intronic
1114365715 14:22025561-22025583 TTCCAACTAGCTCACAGTGCAGG - Intergenic
1114882900 14:26808766-26808788 TTCCATCTGCATGACAGTTTAGG - Intergenic
1115688156 14:35818376-35818398 TCTCATCTAGTTCTCAGTGTAGG + Intergenic
1116744679 14:48802306-48802328 TTCCTTCTGGTTCAAATTTTCGG + Intergenic
1117147723 14:52852061-52852083 TTCCAAATGGGTCACAGTGTTGG - Intergenic
1119646873 14:76354533-76354555 TCCCATTTGGGTCACAATGTTGG - Intronic
1122496217 14:102157572-102157594 TTCCATTTGGTTCAGATAGTAGG + Intronic
1124150192 15:27170655-27170677 TTCCATCAGTTTCCCAGTGGAGG + Intronic
1126059482 15:44766285-44766307 TACCATGTGGTTAACAGTCTCGG - Intronic
1126193005 15:45898585-45898607 TTCCATCTGGTTCTAAGTGGGGG + Intergenic
1131413684 15:92232757-92232779 TTTCACCTGCCTCACAGTGTAGG - Intergenic
1132090930 15:98947517-98947539 TTCCATGTGGTTCACTTTGGTGG - Intronic
1132718426 16:1303822-1303844 TTCCGTCTGTTTCAGAGGGTTGG + Intergenic
1134038756 16:11051845-11051867 TTGCATCTGGCACCCAGTGTTGG + Intronic
1134044061 16:11088573-11088595 TGCCATCTGGTGCACAGCCTCGG + Intronic
1134835771 16:17359325-17359347 TTCCTTCTTGCTCACAGTATGGG - Intronic
1137923487 16:52516090-52516112 GTTCATCTGGTCCAAAGTGTTGG + Intronic
1140743128 16:77959272-77959294 TTCCATCTGGGTCAGAATCTTGG + Intronic
1140822626 16:78677585-78677607 CTCCATGTTGTTTACAGTGTGGG + Intronic
1142497414 17:313712-313734 GTCCATCTCGTTCACGGCGTCGG + Intronic
1142585557 17:970729-970751 TTAGATCAGGGTCACAGTGTTGG - Intronic
1143052358 17:4136733-4136755 TCCCAGCTGGTTCAGACTGTAGG + Intronic
1143770896 17:9168046-9168068 TTCTCTGTGGTTCTCAGTGTTGG - Intronic
1143865808 17:9922402-9922424 TTCCATGAGGTCCACAGTGGTGG - Intronic
1146428755 17:32769726-32769748 TTCCTTTTGGTTCATAGTTTAGG + Intronic
1151011882 17:70508714-70508736 TTCAATAAGGTTCACAGTGTTGG - Intergenic
1152991987 18:372071-372093 TAGTGTCTGGTTCACAGTGTTGG - Intronic
1154124556 18:11678738-11678760 ATGCATCTGGTTCCCATTGTGGG - Intergenic
1156159391 18:34341730-34341752 TTCCATCTTGCTGCCAGTGTGGG + Intergenic
1156491686 18:37500122-37500144 TTCCATTTGGTGCACAGCCTTGG - Intronic
1159227571 18:65559210-65559232 TCCCATGTTTTTCACAGTGTAGG - Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1162225312 19:9216348-9216370 CTGCCTCTGGTTCACTGTGTAGG + Intergenic
1164475299 19:28571019-28571041 TTCCATCTAATTCAGAGTGCTGG + Intergenic
1165430199 19:35767775-35767797 CTCCATCTGAATCCCAGTGTCGG + Intronic
1167728559 19:51235784-51235806 TTCCTCCTGTTTAACAGTGTAGG + Intronic
1168419500 19:56191919-56191941 ATGCATCTGGTTCACAGAGGAGG + Exonic
925982803 2:9190954-9190976 TTCTATCTGATGCACAGTGGTGG + Intergenic
926990871 2:18678080-18678102 TTCTATCTGGTTCACAGTGAAGG + Intergenic
927408175 2:22796071-22796093 TCCCATCCCGTACACAGTGTGGG + Intergenic
929017021 2:37507969-37507991 TTCCATCTGGCACACATTGCTGG + Intergenic
929506711 2:42533951-42533973 TTGCATCTCGTTCACATTATTGG + Intronic
930638961 2:53835931-53835953 TTGCATGTGATTCCCAGTGTTGG + Intergenic
933609273 2:84416865-84416887 ATCCTTCTGGTACACAGTGTTGG - Intergenic
935952818 2:108346279-108346301 TTACATCTGGGTCACAGGTTTGG + Intergenic
936086672 2:109474078-109474100 TTCCATTTGATGCACAGTCTGGG + Intronic
936245847 2:110826813-110826835 TTTCATCTGGTGTACAGTTTTGG + Intronic
938175664 2:129125650-129125672 TTCCGTCTTGTTCACAGTTTAGG + Intergenic
940544702 2:155069227-155069249 TTCCACCTGGTTCATGATGTAGG + Intergenic
941195857 2:162450872-162450894 TGCCACCTGGTTCCTAGTGTAGG - Intronic
943270517 2:185796591-185796613 TTCAACCTGATTAACAGTGTAGG - Exonic
944370062 2:198972886-198972908 TTCTGTCTGGTTCACAGTGTAGG - Intergenic
945322226 2:208437770-208437792 TTCCATTGGGGTTACAGTGTCGG - Exonic
1169875518 20:10293114-10293136 TTCCATCTGCTTCATTCTGTGGG + Intronic
1170575064 20:17656214-17656236 TTCTTTCTTCTTCACAGTGTCGG - Intronic
1172379762 20:34479460-34479482 TCACATCTGTTTCACAGAGTTGG - Intronic
1174189906 20:48732994-48733016 CTCCCTCTTGTTAACAGTGTGGG - Intronic
1175599649 20:60262923-60262945 TTCCATATGGTTTTCAGTGATGG - Intergenic
1175618192 20:60421184-60421206 TTTCGCCTGGTTCACACTGTAGG + Intergenic
1178941543 21:36911058-36911080 TTGCAGCTGGTTCAAAATGTGGG - Intronic
1180165530 21:46023928-46023950 AAGCATCTGGTTCAAAGTGTTGG + Intergenic
1182021802 22:27087832-27087854 TTCCCAGTGGTTAACAGTGTGGG + Intergenic
949802261 3:7916644-7916666 TTCCATCTTTTTTACAGTGTAGG - Intergenic
952319471 3:32262492-32262514 TTCTACCTGGATCACTGTGTTGG + Intronic
952888764 3:38027699-38027721 CTGCATCCGTTTCACAGTGTGGG - Intronic
953613800 3:44471508-44471530 TTACATTTGCTTCACAGTGGTGG - Intronic
953860880 3:46543237-46543259 ATCCACCTGGTTCACAATGGAGG + Intronic
954252628 3:49379941-49379963 TTCCATCTGGCAGACAGTGATGG + Intronic
955181984 3:56681589-56681611 ATCCATCTGGTACAGAGTCTTGG - Intronic
955905592 3:63804266-63804288 TTCCCTCTGGATCAAAGTTTAGG - Intergenic
957067070 3:75533115-75533137 TACCATCTGGTACATAGTGATGG + Intergenic
957677737 3:83392721-83392743 TTTCTCCTGGCTCACAGTGTAGG - Intergenic
959006695 3:101027560-101027582 TTCCATCTGGTTCACAGTATAGG + Intergenic
959244491 3:103847269-103847291 CTCCATCTGGTGCGAAGTGTAGG - Intergenic
960490564 3:118312574-118312596 TTCCTTCTGGGTCCCTGTGTAGG - Intergenic
961570314 3:127793076-127793098 TTCCATCTGGCTCACAGCCAAGG - Intronic
962149856 3:132881351-132881373 TCTCATTTGGTTCACAGTGATGG - Intergenic
963831519 3:150014260-150014282 TCCCATCTGGCCCACAGTTTCGG - Intronic
964796967 3:160509088-160509110 TTAGATCTGTTTCACAGAGTAGG - Intronic
964806751 3:160618519-160618541 TGCCAACTGGGTTACAGTGTTGG + Intergenic
966810631 3:183840924-183840946 TTCAATCTGGATCACTGTGAGGG + Intronic
966859108 3:184218837-184218859 TTCCATCTGGTAGAGGGTGTTGG + Intronic
967434601 3:189430259-189430281 TTCCATCTGGTTCATGCTGTAGG - Intergenic
967682155 3:192376922-192376944 TTCCATGTGTTTCACAGTCCAGG - Intronic
974927551 4:68319139-68319161 TTCCTTCTGCTTCACAGGGAAGG + Intronic
975024215 4:69529519-69529541 TTCCAGCTTGCTCACAGTGGGGG - Intergenic
976119562 4:81764625-81764647 TTTCTTCTGGTGCACACTGTAGG + Intronic
977510331 4:97953779-97953801 TTTCACATGGCTCACAGTGTGGG + Intronic
977625070 4:99180852-99180874 TTCCACCTGGCTCATGGTGTAGG + Intergenic
981033215 4:140146327-140146349 TTCCATCTGTTAAACAGTGGAGG - Intronic
981672351 4:147301425-147301447 TTCTATCTGGTTCAAAATCTAGG - Intergenic
981924015 4:150117747-150117769 TTCCACCTGGCTCATAGTGTAGG + Intronic
984837645 4:184036740-184036762 TTCCTTCTGTTTCTCATTGTTGG + Intergenic
987917217 5:24229266-24229288 TTCCACCTGGCTCACCATGTGGG + Intergenic
988354817 5:30160545-30160567 TCCCATCTGTTCCACAGTGTAGG - Intergenic
988531418 5:32030654-32030676 TTTCATCTCTTTCACAGTGATGG - Intronic
990278109 5:54221092-54221114 TTCAATCTGTATCACAGTTTGGG + Intronic
992136772 5:73753581-73753603 TTCCAGGTGTTTCACAGAGTTGG - Intronic
993331729 5:86608735-86608757 TGACATATGGTTCTCAGTGTTGG + Intergenic
994712377 5:103281354-103281376 TGCCTTATGGGTCACAGTGTGGG - Intergenic
996478859 5:123950397-123950419 ATCCCTCTGCTTCCCAGTGTAGG - Intergenic
997388373 5:133493433-133493455 TTCAATGTGGTTCAAAGTCTAGG + Intronic
1000713594 5:164611281-164611303 TGCCATTTTTTTCACAGTGTGGG - Intergenic
1003774185 6:9340761-9340783 TTTCATCTGATTTACAGGGTAGG - Intergenic
1006431413 6:33999498-33999520 TTCCATCTGGTGCACAGCTCTGG + Intergenic
1008230272 6:48978729-48978751 TTTCACCTAGCTCACAGTGTAGG - Intergenic
1009396788 6:63207994-63208016 CTATATCTGGTTCAAAGTGTTGG - Intergenic
1012386380 6:98688176-98688198 TTCCTTCTGATTCACAGAATTGG + Intergenic
1013304925 6:108838954-108838976 GTCCATCTGGGTCACGGAGTGGG - Intergenic
1015065671 6:129023695-129023717 TTCTATCTGGTTTACATTGCTGG + Intronic
1015829270 6:137350288-137350310 TGAAATTTGGTTCACAGTGTTGG - Intergenic
1018608538 6:165624063-165624085 TTCAGTCTGGTTCAAAGTCTTGG + Intronic
1019701488 7:2476642-2476664 TTCCAGCTGGTTCTCTGTGCAGG + Intronic
1020066780 7:5194301-5194323 TTGCTTTTGGTTTACAGTGTCGG + Intronic
1020450609 7:8316574-8316596 TTCCATCTGGTTCACAGTGTAGG + Intergenic
1022032741 7:26507021-26507043 ATCCTTCTGGTTCACAGTAATGG - Intergenic
1023046726 7:36216261-36216283 TTCCATGTGACTCACAGTGGTGG + Intronic
1026209116 7:68287615-68287637 CTCCAGCTGGTTCCCAGTGGGGG - Intergenic
1026614431 7:71888921-71888943 TTCCCTTTTGTTCACAATGTAGG + Intronic
1029014683 7:97303475-97303497 TTCCAGGTGGTACACAGTGATGG + Intergenic
1030255731 7:107507175-107507197 TTTCACCTGGCTCACAGTATAGG + Intronic
1031264103 7:119561968-119561990 ATCCATCTAGTTCACATTGCTGG + Intergenic
1032907544 7:136387871-136387893 TTCAAACTAGTTCACAGTGATGG - Intergenic
1033395878 7:140973349-140973371 TTCCACTTGGTTCACAATATGGG + Intergenic
1035942770 8:3921895-3921917 GTCCATCTGGTCCATACTGTTGG + Intronic
1036886636 8:12561377-12561399 TACCATCTGGTACATAGTGATGG + Intergenic
1036918405 8:12828042-12828064 TTCCAGCTGTGTAACAGTGTGGG + Intergenic
1037297407 8:17415368-17415390 TTCCAGCAGTTTCACAGTTTTGG - Intergenic
1038117035 8:24568371-24568393 TTACCTCTGGTTCACAGTCTGGG + Intergenic
1039580169 8:38659276-38659298 TTCCAACTTGATCACAGTATAGG - Intergenic
1044278501 8:90329540-90329562 TTTCATCTGAGTCACAGTGATGG - Intergenic
1047021939 8:120784847-120784869 TTTCTCCTGGTTCACAGTGTAGG - Intronic
1047384489 8:124396355-124396377 TTCCACCTGGCTTACTGTGTAGG + Intergenic
1048799104 8:138179920-138179942 ATCCACCTGCTTCAGAGTGTTGG + Intronic
1058120650 9:101135091-101135113 TTGCAACTGCATCACAGTGTGGG + Intronic
1058798826 9:108525039-108525061 TTCCATATGGTTTTCACTGTTGG + Intergenic
1061815684 9:133193544-133193566 TTCCTTCTTTTTCACATTGTGGG + Intergenic
1062667450 9:137682932-137682954 TTCCAACTGGTGCAGCGTGTGGG - Intronic
1062685602 9:137811405-137811427 TTCCTGCTGGCTCACAGTGCTGG - Intronic
1203781580 EBV:103976-103998 CTCCATAAGGTTCACATTGTTGG - Intergenic
1185672619 X:1824765-1824787 TGAAATCTGGTTCCCAGTGTTGG - Intergenic
1188790785 X:34405585-34405607 GCCCCTCTGATTCACAGTGTAGG + Intergenic
1188867313 X:35328797-35328819 TTCTAACTGGTTTAGAGTGTAGG - Intergenic
1189994005 X:46621544-46621566 TACCACCTGGAGCACAGTGTAGG - Intronic
1190934543 X:54984912-54984934 TTCCATCTTGCTCACAGGGTAGG + Intronic
1191786303 X:64920248-64920270 TTCCATCTGGAACATAGAGTGGG + Exonic
1191894763 X:65980352-65980374 TTCCATCTGAGTCTCCGTGTAGG - Intergenic
1192727390 X:73767169-73767191 TTCTGCCTGGCTCACAGTGTAGG + Intergenic
1193308415 X:79976246-79976268 TTCTACCTGTCTCACAGTGTAGG + Intergenic
1193386762 X:80882522-80882544 TTTCACCTGGCTCACGGTGTAGG - Intergenic
1193517353 X:82483784-82483806 TTGCACATGGTTTACAGTGTTGG - Intergenic
1194335911 X:92645440-92645462 TTCCTTCTGGTTCATATTGTAGG + Intergenic
1196748236 X:119090854-119090876 TTCCATCTGGTTCACAGTGTAGG - Intronic
1197538431 X:127723091-127723113 TTTCACCTGGCTCACAATGTAGG + Intergenic
1198685379 X:139222965-139222987 TTCCAACTTGTTCTAAGTGTAGG + Intergenic
1200424376 Y:3005412-3005434 TTGTATCTGGTTCACAGCGAGGG - Intergenic
1200644346 Y:5762191-5762213 TTCCTTCTGGTTCATATTGTAGG + Intergenic
1200979900 Y:9253848-9253870 TGCCTTCTGGTTTACAGTGATGG + Intergenic