ID: 1069276000

View in Genome Browser
Species Human (GRCh38)
Location 10:66591644-66591666
Sequence TTAAAATTCCACCACAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 251}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069276000 Original CRISPR TTAAAATTCCACCACAGGAA AGG (reversed) Intronic
900939921 1:5792090-5792112 TTCTAATCCCACCACAGGAAGGG - Intergenic
903124993 1:21241718-21241740 TTCAAATTCCACCTCAGGCCGGG - Intronic
905318131 1:37096535-37096557 ATAAAATTCTACCCCAGGGAGGG - Intergenic
906882321 1:49605261-49605283 CTAAAATTCTACCAAAGGAGCGG + Intronic
907945934 1:59136701-59136723 TTAAAATTACATCTCAGCAAAGG + Intergenic
909120225 1:71593967-71593989 TTTAAATTCCTCAAAAGGAAAGG + Intronic
909161674 1:72158816-72158838 TTTAAAGTCCACCAGAGTAATGG - Intronic
909361836 1:74768717-74768739 TTTAAATTCAACCACATTAAAGG - Intergenic
910804534 1:91177503-91177525 TTAAAACTCCAGCATAGGATTGG + Intergenic
910871297 1:91835532-91835554 TTAAAATGCCAACACAGGCCAGG + Intronic
911585487 1:99685384-99685406 TTAAAATTCCTCCACATCCATGG - Intronic
913396904 1:118381581-118381603 CTTTAATTCCAACACAGGAAAGG + Intergenic
913440842 1:118895638-118895660 TGAAGATTCTACCTCAGGAATGG - Intronic
913978479 1:143487092-143487114 TTAAAAATCAACCAGAGGTAGGG + Intergenic
914072890 1:144312740-144312762 TTAAAAATCAACCAGAGGTAGGG + Intergenic
914106264 1:144653620-144653642 TTAAAAATCAACCAGAGGTAGGG - Intergenic
916344949 1:163777166-163777188 TTAAAATTCTATCCCAGAAATGG - Intergenic
916693949 1:167218434-167218456 CTAAAATTCAAACACAGGCAAGG - Intergenic
916736791 1:167614649-167614671 TAAAAATTCCTCCACATTAAAGG - Intergenic
918492115 1:185092187-185092209 GTAAGATTCCATCTCAGGAAAGG - Intronic
919093979 1:193007997-193008019 TGAAAATTACAACAAAGGAAAGG + Intergenic
919186948 1:194163262-194163284 TTGAAAATCCACAAGAGGAAGGG + Intergenic
919699912 1:200620944-200620966 TTTAAATCCGACCAGAGGAAGGG + Intergenic
920149093 1:203889572-203889594 TCAAAATTTCAACTCAGGAATGG - Intergenic
920449834 1:206051700-206051722 TTAAAATCTCACCACTGGAGGGG - Intronic
920716763 1:208347376-208347398 ATAAAATTACACCATATGAAGGG - Intergenic
921243183 1:213208131-213208153 TTAAAATTCCATCAGAGGGTTGG - Intronic
921877197 1:220211143-220211165 GTAAAACTCCACCACTGGTAAGG + Intronic
921979354 1:221238681-221238703 TTTTAATTCTAACACAGGAATGG - Intergenic
923048667 1:230374557-230374579 CTATAATCCTACCACAGGAAGGG - Intronic
924190260 1:241544078-241544100 TAAAAATTCAACCACAGTAAAGG - Intronic
1063045021 10:2383034-2383056 TTTCAATTTCACCACTGGAAGGG + Intergenic
1064146178 10:12828237-12828259 TTAAAATTACACCAAAAAAAAGG + Intronic
1064443730 10:15375215-15375237 TTAAAATTCCACCACGGGGTCGG - Intergenic
1064940336 10:20727183-20727205 TTAAAGTTCCAACACAGACAAGG + Intergenic
1064968947 10:21044099-21044121 TTAAAAAGCCACCATAGGCAGGG + Intronic
1065227427 10:23558734-23558756 CTAAAATTGCACCACAGAGAGGG - Intergenic
1065582798 10:27188672-27188694 TTGAAATTCAGCCACAGGTAAGG + Intergenic
1066559350 10:36652354-36652376 TTAAAAAGCCACCACAGGCCAGG + Intergenic
1066578395 10:36851920-36851942 TTAAAAATCTACCACAAGATTGG - Intergenic
1068465315 10:57382213-57382235 TTAAAATACCACTACAGGCTGGG - Intergenic
1069276000 10:66591644-66591666 TTAAAATTCCACCACAGGAAAGG - Intronic
1070192414 10:74124081-74124103 TTAAGATTCCCACACAGGCAGGG + Intronic
1073740021 10:106395891-106395913 TTGGAATTCCACCAGATGAAGGG + Intergenic
1074093606 10:110287510-110287532 TTTAAATTGCAGAACAGGAATGG - Intergenic
1074328289 10:112474910-112474932 TTCAAAGGCCAACACAGGAAAGG + Intronic
1074427227 10:113362209-113362231 TTAAAATGCAACCAAAGGACTGG - Intergenic
1074481240 10:113822942-113822964 TTAAAATTCCACCTCAGAGCTGG + Intergenic
1075944854 10:126424000-126424022 CTAAAATACCACCTCAGGGAGGG - Intergenic
1078144343 11:8712811-8712833 TTAAAAGTGCTCCACAGCAATGG - Intronic
1079735076 11:23987025-23987047 TTAAAATACCTCCAGGGGAAAGG - Intergenic
1079824420 11:25173488-25173510 TTAAAAAACAACCACAGGACAGG - Intergenic
1080263089 11:30371729-30371751 ATATAATTACACCAAAGGAAAGG - Intergenic
1081102768 11:39025650-39025672 TTACAGTTGCACCACAGGATTGG + Intergenic
1082926769 11:58556333-58556355 TTGATATTCAACAACAGGAATGG - Intronic
1085567118 11:77524303-77524325 TTAAATTTCAGCCACAGGAAGGG + Intronic
1086147748 11:83572055-83572077 TCATAATTCCACCACTGCAAAGG - Intronic
1087975487 11:104540803-104540825 TTAAAATACCACCATAAAAAAGG - Intergenic
1090887626 11:130893142-130893164 TAGAACTCCCACCACAGGAAAGG + Intronic
1091321898 11:134657641-134657663 TTAAAAGTCAACCTCAGAAAGGG + Intergenic
1093560469 12:20533296-20533318 GTAAAATTCCACCTCAGAAATGG + Intronic
1096479222 12:51926852-51926874 TTACAAATCCAACACAAGAAGGG - Intergenic
1096836143 12:54352492-54352514 TTAAAAATCCTGCAGAGGAAGGG - Intergenic
1098417467 12:70251820-70251842 CAAAAATTCCACCCCAGTAACGG - Intronic
1099826391 12:87782014-87782036 TTAAAATTCCAACAGAGGCCGGG - Intergenic
1101106014 12:101440827-101440849 TTCAAATGCCACCACAGAGAGGG + Intergenic
1104261702 12:127189510-127189532 TTAAAATTCCACACCATTAATGG - Intergenic
1105619232 13:22051086-22051108 TGAAAGGGCCACCACAGGAAAGG + Intergenic
1107528353 13:41256617-41256639 TTAAAATTCTACAACAGGCCGGG - Intronic
1109738593 13:66520609-66520631 TGAAGATTCCACCATTGGAAAGG - Intronic
1109888076 13:68568555-68568577 TTAAAATTCCACAACTGGATTGG - Intergenic
1110035808 13:70682053-70682075 TTAACTTTCCAAGACAGGAATGG - Intergenic
1110123367 13:71910603-71910625 TTAGAATTCCATAACAGAAAAGG - Intergenic
1110425227 13:75359484-75359506 CAAAAATTCCATCACTGGAAGGG + Intronic
1110686143 13:78376749-78376771 TTAAAATCCTACCATAGGGAAGG + Intergenic
1110688272 13:78401089-78401111 TAAAAATGCCACCACTTGAAAGG - Intergenic
1111031945 13:82611959-82611981 TTAAAATTACACTATAGGCAGGG + Intergenic
1111335983 13:86824047-86824069 TTATAATTCCACCAGAAAAATGG + Intergenic
1111668956 13:91304057-91304079 TTAAAATTAGACTACAGAAAGGG - Intergenic
1111925730 13:94461500-94461522 TTAATCTTCCACCACAGGTTGGG - Intronic
1113419714 13:110161309-110161331 TTAATATTGCAGAACAGGAAGGG + Exonic
1115296535 14:31834112-31834134 GAAAAATTAAACCACAGGAAAGG - Intronic
1115825792 14:37272459-37272481 TCAAAAGTCCACCAAAGAAAGGG - Intronic
1118303669 14:64636763-64636785 TGAAAATTACAACACAGGCATGG + Intergenic
1118675625 14:68181569-68181591 TTAAAATTTCACTACTGGAGGGG - Intronic
1123184013 14:106497152-106497174 TTAAAATTGCACCAGAGGCCAGG - Intergenic
1124269147 15:28265390-28265412 ATAAAATGCCCACACAGGAACGG + Intronic
1124850953 15:33338544-33338566 TTAAAATTTCACCACGGCAATGG - Intronic
1125132975 15:36305763-36305785 TTATATTCCCCCCACAGGAATGG - Intergenic
1125922150 15:43531335-43531357 TGAAAATACCACCCCAGGAGAGG + Exonic
1126059708 15:44768468-44768490 TTAAAATTACAGGACAGGCATGG - Intergenic
1126079987 15:44950379-44950401 TTACAATTCCAACAAAGGAGTGG - Intergenic
1126919013 15:53499535-53499557 TTAAAATTTTATAACAGGAATGG + Intergenic
1127097352 15:55526475-55526497 TTGAAATTACACCACAGTTAAGG - Intergenic
1127255047 15:57283173-57283195 GTAAAATTCCACCAGAGAGAAGG - Intronic
1127369626 15:58326594-58326616 AGAAAGTTCTACCACAGGAATGG - Intronic
1138404706 16:56781078-56781100 TTAAAAGTGCTCCTCAGGAAGGG - Intronic
1140677673 16:77349343-77349365 TTAAAATTTCACCATGGCAATGG + Intronic
1140700202 16:77574584-77574606 TTAAAAGTCCTTCACTGGAATGG - Intergenic
1142241325 16:88948052-88948074 TTAAACACCCACCACGGGAATGG - Intronic
1144524038 17:15974761-15974783 TTACTGTTCCACCCCAGGAATGG - Exonic
1146239344 17:31202447-31202469 TTAATTTTCCACTGCAGGAATGG - Intronic
1149210659 17:54296469-54296491 TTGAAATTCTAACACAGGGATGG - Intergenic
1153663853 18:7350790-7350812 TTTGATCTCCACCACAGGAAGGG - Intergenic
1154941901 18:21122005-21122027 TTTACATACCACCAAAGGAAAGG + Intergenic
1155962490 18:32006333-32006355 GAAAAATTCCCCCAAAGGAAGGG + Intergenic
1157049579 18:44146289-44146311 TTAAAATTAAACCACAGGGGAGG + Intergenic
1158348925 18:56544399-56544421 TTAAAATCCCAGCCCAGGGATGG + Intergenic
1159679129 18:71325599-71325621 TTAAAATTTCAACACAGGACAGG - Intergenic
1160754231 19:749338-749360 TTAAAATCGCGCCTCAGGAATGG - Intergenic
1160981418 19:1818235-1818257 TTCAAATGCCACCACCTGAAAGG - Intronic
1161854884 19:6758605-6758627 TGAAAATTAAAACACAGGAAGGG - Intronic
1166244979 19:41518878-41518900 TGAAAACTATACCACAGGAAAGG + Intergenic
925681369 2:6425434-6425456 TTAAAATGACCCCACAGGGAAGG + Intergenic
926303324 2:11619026-11619048 AGAAGATTCCACCACGGGAAGGG - Intronic
927413986 2:22857336-22857358 AATAAATTCCACCAGAGGAAGGG + Intergenic
928642851 2:33318851-33318873 TTAAAATTCCACAATAAAAAAGG - Intronic
930530188 2:52580117-52580139 TCAAAATTTCTGCACAGGAAAGG + Intergenic
932069625 2:68606417-68606439 TTTAACTTCCACAGCAGGAAGGG - Intronic
932118369 2:69075261-69075283 GTAAAAATCCATCAAAGGAATGG + Intronic
932663688 2:73679389-73679411 TCAAAATTGCACCAAATGAAAGG + Intergenic
933211203 2:79571321-79571343 TTATAATTTCAGAACAGGAAAGG + Intronic
934183205 2:89648173-89648195 TTAAAAATCAACCAGAGGTAGGG + Intergenic
934293485 2:91722343-91722365 TTAAAAATCAACCAGAGGTAGGG + Intergenic
935339168 2:102044586-102044608 TTAAAATTCAATGACAAGAAGGG - Intergenic
937386232 2:121436010-121436032 GTAAAATTGCACAACACGAAAGG - Intronic
938642721 2:133298471-133298493 TTAAAATTCCATTTCAGGCATGG - Intronic
938898575 2:135777589-135777611 TTAAAACTCCACCTCAGGCCAGG + Intronic
939312000 2:140492289-140492311 CTGAAAATACACCACAGGAATGG + Intronic
940496729 2:154438676-154438698 TTAAAATGCCACCATATGAGAGG + Exonic
940545803 2:155083075-155083097 TTAAATTTTCAGAACAGGAAAGG + Intergenic
940573785 2:155473230-155473252 TTAAATTTTCAGAACAGGAAGGG + Intergenic
940772270 2:157852051-157852073 TTAAAATGCTTCCTCAGGAAGGG + Intronic
942515884 2:176752738-176752760 TTTAAATACCAGCATAGGAATGG - Intergenic
943402072 2:187426021-187426043 ATAAAATTCTATAACAGGAAGGG - Intronic
943955265 2:194180666-194180688 TGGAAATTCCACAACAGAAAAGG - Intergenic
943975145 2:194466661-194466683 TTAAAAGTACATCACAGAAAAGG + Intergenic
943975280 2:194468898-194468920 TTGAAATTTAACCTCAGGAAAGG - Intergenic
945885048 2:215366124-215366146 TTAAAATTCAACCAAAGAAATGG - Intronic
946066796 2:216994818-216994840 TGAAAATCCCAGGACAGGAAGGG + Intergenic
946683451 2:222242290-222242312 TAAAAAATCCATCACAAGAAGGG - Intronic
946738274 2:222776196-222776218 TGAAAATTCCTCCACTGGAAAGG + Intergenic
946975065 2:225139296-225139318 ATAACATTCCGCTACAGGAATGG - Intergenic
1169073278 20:2746736-2746758 TTAAAGTTCCACCCCAGGTTTGG + Intronic
1169128784 20:3151776-3151798 TTAATACTACAGCACAGGAAAGG + Intronic
1169791401 20:9414084-9414106 TTAAAATACCTTCACAGAAAAGG + Intronic
1173670104 20:44793035-44793057 TTAAAATTCAACCACCAGGATGG + Intronic
1174211361 20:48881248-48881270 TTAAATGTACACCACAGTAAAGG - Intergenic
1175132769 20:56801925-56801947 TTAAAATTCCACCATACGTCAGG - Intergenic
1177861265 21:26457361-26457383 TTAAAAAGCCAGCACAGAAAAGG + Intergenic
1180685492 22:17663190-17663212 ATAAATTTCTACCACAGCAATGG + Intronic
1181744855 22:24948899-24948921 ATAAAATTCCAGCTCAGTAAGGG - Intergenic
1182294531 22:29305321-29305343 TTAAAATCCCTCATCAGGAAAGG - Intergenic
1184547554 22:45181835-45181857 TTATAAGTCCTCAACAGGAAGGG - Intronic
949647905 3:6119017-6119039 ACAAAAATCCACCACAGGAATGG + Intergenic
951069046 3:18304108-18304130 GTATAATTCAATCACAGGAAAGG - Intronic
951190163 3:19758685-19758707 TAAAAATCCCACCACAGGTCAGG - Intergenic
951330386 3:21360832-21360854 TTAAAACTCAAGCACAGAAATGG + Intergenic
951685666 3:25341509-25341531 TTAAAAGTTTACCAAAGGAAGGG + Intronic
953301473 3:41780908-41780930 TTCAAATTCCCACACAGAAAGGG + Intronic
954086226 3:48246015-48246037 TTAAAATTCCACAATAGGCCAGG + Intronic
955375376 3:58391183-58391205 TTAAAAATCAGCCAAAGGAACGG + Exonic
957210694 3:77254483-77254505 TTAAGTTTCCACCATAGGAGAGG - Intronic
958030754 3:88106295-88106317 TTCAACTTACAGCACAGGAAGGG - Intronic
959148274 3:102575738-102575760 TTAAAATTCTAAGACATGAAAGG - Intergenic
959467800 3:106710648-106710670 TTTAAATTCCAGCTCAGAAATGG - Intergenic
959640277 3:108624202-108624224 TTAAAATTTAATCAAAGGAAAGG - Intronic
961406096 3:126680621-126680643 ATAAAATTCGCCCACAGGATAGG + Intergenic
961803797 3:129474080-129474102 TTGAAATTCCTATACAGGAAAGG + Intronic
961961186 3:130857008-130857030 TACAAATTCCTCCACAGGAGTGG - Intronic
962890504 3:139668111-139668133 TAAAAATGCCAGCAGAGGAAAGG + Intronic
963036915 3:141038483-141038505 TTAAAATTGCACTACATGTAAGG + Intergenic
965857837 3:173110383-173110405 TTAAAATTTAACCAAAGCAAGGG - Intronic
966938212 3:184728187-184728209 TTAAAATTTTACCACAGGGCCGG - Intergenic
967821054 3:193839406-193839428 TTAATCTTCCACTAGAGGAAAGG + Intergenic
967900484 3:194445827-194445849 AGAAAATTCCAGCTCAGGAAAGG + Intronic
967921979 3:194620555-194620577 TTAACATTCCACCTCAGGACCGG + Intronic
969491952 4:7504552-7504574 TTCAAATCCCACCACAGCCATGG - Intronic
970131357 4:12875321-12875343 TTCAAGTTCCACCACATGACAGG - Intergenic
970802789 4:19994720-19994742 TTAAAATTATACAACATGAAGGG - Intergenic
971985037 4:33811127-33811149 TTAAAATTCCAGCATAGCCACGG + Intergenic
976531074 4:86152490-86152512 TTTAAATTCCATCACAGGAGAGG + Intronic
976535529 4:86210288-86210310 TAAAAACTCCTCCACAGCAAAGG + Intronic
976966730 4:91051945-91051967 TTAAAAATCTACCACAGTAAGGG + Intronic
978453066 4:108858115-108858137 TGAAAAGTTCTCCACAGGAAGGG + Intronic
981597182 4:146439451-146439473 TTATATTTATACCACAGGAATGG + Intronic
981836250 4:149057680-149057702 TTTAAATAACAACACAGGAATGG - Intergenic
984095660 4:175429286-175429308 TGAATGTTCCACCCCAGGAAAGG + Intergenic
984482401 4:180322710-180322732 ATGAAAGTCCATCACAGGAAGGG + Intergenic
985264452 4:188145043-188145065 TGAAAATTCTACAAAAGGAAAGG - Intronic
986507410 5:8466686-8466708 TTAAAATTTCACCATGAGAATGG - Intergenic
986564985 5:9103809-9103831 TGAAAATTACAACACATGAAAGG - Intronic
987028111 5:13948608-13948630 TTAAAATTGCAGCACAAGACGGG - Intergenic
988410952 5:30885094-30885116 TTAAAATTCCACAGCTGGAAGGG - Intergenic
991017183 5:61944873-61944895 TTAAAATCCTACCAGAGGCAGGG - Intergenic
991075574 5:62532651-62532673 TTAAAACTACACCACAGGCTGGG - Intronic
993297206 5:86155985-86156007 TTACAATTCCACCACTGGGGAGG + Intergenic
994806852 5:104459008-104459030 TGAAAATTACACATCAGGAATGG - Intergenic
994868445 5:105311541-105311563 TTAAAAGTTCACCACATGTATGG - Intergenic
996136968 5:119854848-119854870 TTAAAATTCTACTACAGGCTGGG - Intergenic
996200812 5:120670255-120670277 TTAAAATTAAACAACATGAATGG + Intronic
997836942 5:137202205-137202227 TTCCAATCCCAACACAGGAAAGG + Intronic
999526509 5:152411932-152411954 GGAAAATTCCACCACCTGAAGGG + Intronic
1001818967 5:174694682-174694704 TTGAAATTGCACCACAGGGAGGG + Intergenic
1003045657 6:2730616-2730638 TTAAAAATCCAGGACAGTAATGG + Intronic
1003087915 6:3076337-3076359 TTAACATTCCACCACATGCTTGG - Intronic
1004193162 6:13482449-13482471 TTAAAATTCCCACACAGGCCAGG + Intronic
1004246110 6:13977556-13977578 ATAAAATTCTACCACAGGAGTGG - Exonic
1004383818 6:15155043-15155065 TTAACTTTCCAACACATGAATGG - Intergenic
1004546178 6:16600552-16600574 TTAAAACTCCAACAAAGGAAAGG + Intronic
1004607106 6:17205149-17205171 TTAGAATTCCAGAGCAGGAAGGG - Intergenic
1008977652 6:57446692-57446714 TTTAAATTTCAACACAGGAATGG + Intronic
1009165790 6:60339639-60339661 TTTAAATTTCAACACAGGAATGG + Intergenic
1009286349 6:61823173-61823195 TTAATATTCCACCACAACCAAGG + Intronic
1010941699 6:81926590-81926612 TTAAAACTCCAAGGCAGGAATGG - Intergenic
1011207858 6:84920283-84920305 TTCCATTTCCACCACAGTAATGG + Intergenic
1011328466 6:86176605-86176627 TTAAAATTCCATCATATGCATGG + Intergenic
1013532398 6:111032117-111032139 TGAAGATCCCACCAGAGGAAGGG - Intergenic
1016105262 6:140154431-140154453 TAAAAATTCCTCCACAGTATTGG - Intergenic
1016605311 6:145915013-145915035 TTAAGATTCCTTCAGAGGAATGG - Intronic
1017136643 6:151153043-151153065 GTGAACTTCCACCAGAGGAAGGG - Intergenic
1017973236 6:159331078-159331100 TTAAAATTACATCACAGGGGAGG + Intergenic
1019717961 7:2549736-2549758 ATAAAATGCAACGACAGGAAAGG + Intronic
1020482857 7:8683470-8683492 TTAGAATTCTTACACAGGAATGG + Intronic
1021163780 7:17308243-17308265 TAAGAATTCCCCCACATGAAGGG - Intronic
1026772869 7:73213239-73213261 TCAAATATGCACCACAGGAATGG - Intergenic
1027013732 7:74766635-74766657 TCAAATATGCACCACAGGAATGG - Intergenic
1027074306 7:75179397-75179419 TCAAATATGCACCACAGGAATGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1030063398 7:105640767-105640789 TTAAAATTCCACCTCTTGGATGG + Intronic
1030111184 7:106028476-106028498 TTAAAATTCCACCTCCACAACGG - Intronic
1030535309 7:110758982-110759004 TTAAATTTCCTCCAGATGAAAGG + Intronic
1031492547 7:122406877-122406899 TTAAAAAAGCATCACAGGAAAGG + Intronic
1031604560 7:123752672-123752694 TTTATATTCCCCCACAGTAAAGG - Intergenic
1031726900 7:125251237-125251259 TTAAAACTACATCACAGGACAGG - Intergenic
1033315996 7:140298070-140298092 TTAAAATGCCATCAAAAGAAAGG + Intronic
1034195228 7:149241136-149241158 TTAAAGGTCCACCACAGGCCAGG + Intronic
1035094098 7:156339577-156339599 TTAAAATTCCTCTGCAGGTATGG - Intergenic
1037413385 8:18620883-18620905 TTAAATTACCACAACAGGGATGG + Intronic
1037524799 8:19714260-19714282 TTATAATTCAGCCAGAGGAAAGG - Intronic
1038343410 8:26709046-26709068 TGAAGACTCCACCTCAGGAAAGG - Intergenic
1038788079 8:30640521-30640543 TTAAAATTTGATTACAGGAATGG - Intronic
1038952237 8:32428243-32428265 ATATAATTCCACCCCAGGAGGGG + Intronic
1039736903 8:40342577-40342599 ATAAAATTCTTCCAGAGGAAAGG + Intergenic
1041505330 8:58591152-58591174 TTAAAAATCCAGCACAGACATGG + Intronic
1041579991 8:59447527-59447549 TCAAATTCCCACCACAGGGATGG + Intergenic
1042031327 8:64479062-64479084 TAAACATACCAGCACAGGAATGG + Intergenic
1042271993 8:66963594-66963616 TTAAAATGTCACTACAGAAATGG + Intergenic
1043291799 8:78611249-78611271 TTTATATTGCACCATAGGAAGGG + Intergenic
1044547243 8:93473411-93473433 GTATAATCCCACCACAAGAAGGG + Intergenic
1046580111 8:116081965-116081987 TTAAACTTCCACCTAAAGAAAGG - Intergenic
1048148266 8:131867231-131867253 TTAAAATTGCAAAACAGAAATGG + Intergenic
1048949722 8:139485926-139485948 TTAAAACTCCAGCAAAGGACTGG + Intergenic
1050001742 9:1084559-1084581 TTCAAATTCAAACACTGGAAAGG + Intergenic
1050635244 9:7605503-7605525 TTAAAATTCCTACAGAGCAAAGG - Intergenic
1051628968 9:19125579-19125601 TTAAAAATCCCCCAGAGGATGGG - Intronic
1054973504 9:71116227-71116249 TTAAATTTCCACCACAAGAGAGG - Intronic
1055398085 9:75894232-75894254 GTAAATTTTCACCACAGTAAAGG + Intronic
1058000874 9:99863682-99863704 TTAAAAGACCACCAGAGTAAGGG + Exonic
1185634898 X:1544492-1544514 TTAAAATTAGACCACAGGGCCGG - Intergenic
1186289789 X:8084028-8084050 AGAAAATCCCACCACAGGCAAGG + Intergenic
1187340283 X:18415065-18415087 TTAAATTTCCAACACATGAAAGG - Intergenic
1189762004 X:44331462-44331484 ATACATTTCCACCACAGTAAAGG - Intronic
1190870157 X:54418102-54418124 GTCACATTCCCCCACAGGAATGG - Intergenic
1192397945 X:70802959-70802981 TTTAAATTCCACCAGAACAATGG + Intronic
1194539184 X:95149590-95149612 TTAAAAATCAACAACAGAAAAGG - Intergenic
1194846623 X:98817373-98817395 TTAAAAGGCCACCATAGAAAGGG + Intergenic
1194862881 X:99026060-99026082 TTAAAGTTTCAGCACAGTAAAGG - Intergenic
1195134567 X:101891663-101891685 TGAAAAGTCCACCAAAGCAAAGG + Intronic
1195162224 X:102181935-102181957 TTAAAATTCAAGGACAGGAGAGG + Intergenic
1195915532 X:109931511-109931533 ATAAAATTCTATAACAGGAAGGG - Intergenic
1197104607 X:122699342-122699364 CTAAAATTCCACAACAAGAGAGG - Intergenic
1197760736 X:130026099-130026121 TTAGAAATCCACTATAGGAATGG - Intronic
1199542846 X:148976842-148976864 TTAATATTGCAACAAAGGAAGGG + Intronic