ID: 1069281941

View in Genome Browser
Species Human (GRCh38)
Location 10:66665613-66665635
Sequence GCATTGAAACAGATGGGTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069281941_1069281950 14 Left 1069281941 10:66665613-66665635 CCCCGACCCATCTGTTTCAATGC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1069281950 10:66665650-66665672 AAGGCCACATTTGTCCATTGAGG No data
1069281941_1069281952 23 Left 1069281941 10:66665613-66665635 CCCCGACCCATCTGTTTCAATGC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1069281952 10:66665659-66665681 TTTGTCCATTGAGGATTTAAAGG No data
1069281941_1069281947 -5 Left 1069281941 10:66665613-66665635 CCCCGACCCATCTGTTTCAATGC 0: 1
1: 0
2: 0
3: 4
4: 46
Right 1069281947 10:66665631-66665653 AATGCCAGCATAGGCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069281941 Original CRISPR GCATTGAAACAGATGGGTCG GGG (reversed) Intronic
920122416 1:203668656-203668678 CCAGTGACACAGATGGGTCCTGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
1067924333 10:50492728-50492750 GCATTGAATCAGATTGGTTTGGG - Intronic
1069281941 10:66665613-66665635 GCATTGAAACAGATGGGTCGGGG - Intronic
1073838227 10:107469044-107469066 GCATTGATAGAGATGGGATGGGG + Intergenic
1087137097 11:94732033-94732055 GCTTTGAAGCAGGTGGGTCAAGG - Intronic
1089578542 11:119465145-119465167 GCATTGAAACCATTGGGTCCTGG + Intergenic
1089869255 11:121657521-121657543 GTATTGGAACAGATGTGTGGAGG - Intergenic
1090556068 11:127878012-127878034 GCATTGAAACAGAGGGGATTAGG - Intergenic
1091816093 12:3439272-3439294 ACATTAAAACAGATGGGTGGAGG - Intronic
1092995686 12:13948287-13948309 GCATTTAAACATATGGGGCAGGG - Intronic
1095361119 12:41340752-41340774 GCAGTGAAGCCAATGGGTCGTGG - Intronic
1096080002 12:48826903-48826925 GCAGTGATAGAGATGGGTGGGGG + Intronic
1102485962 12:113257179-113257201 GCATTTCAAAAGATGGGTAGTGG - Intronic
1103149535 12:118624879-118624901 GCATGGAATCAGATGTGTCTGGG + Intergenic
1117888973 14:60397850-60397872 GCGAAGAAACAGAAGGGTCGCGG + Intronic
1118839785 14:69501659-69501681 TCATTAAAACAGAAGGGTAGAGG - Intronic
1121805967 14:96823084-96823106 GCAGTGAAACAGAGTGGTCATGG - Intronic
1125637978 15:41205258-41205280 GCATTGGAACAGGAGGGTAGAGG + Intronic
1128734777 15:70047119-70047141 GCATTGCAACAGAGGGCTAGGGG - Intergenic
1132391569 15:101442563-101442585 TCATTGAAGCAGGTGGGTTGGGG + Intronic
1153983885 18:10335893-10335915 ACATTGAAACAGATGGTTCAAGG - Intergenic
1162480778 19:10925852-10925874 GCATGGAAAGAGAAGGGTGGAGG - Intronic
1164473845 19:28557364-28557386 GTAGTGAAACAGATGAGTCCTGG + Intergenic
1167337908 19:48897810-48897832 GTAGGGAAACAGATGGGTAGGGG - Intronic
929787790 2:45004599-45004621 GCAGTGAAACTGAAGGGTCAGGG - Intergenic
933860484 2:86461886-86461908 GCAGTGAAAGAGATGGGGGGAGG + Intronic
1170722395 20:18895084-18895106 CCATTGTAACAGATGTGTAGGGG - Intergenic
1173845031 20:46182808-46182830 ACAAAGAAACAGATGGGTTGGGG + Intronic
1181622038 22:24097947-24097969 ACATTGAAACAGATGTGTACTGG - Intronic
952624257 3:35384528-35384550 GCAGTGAACCAGATGGGTCATGG - Intergenic
964589613 3:158345614-158345636 GCATTGAAAAAGAAGGGTAGAGG + Intronic
966426685 3:179787546-179787568 GAATACAAACAGAGGGGTCGTGG - Exonic
972832186 4:42826946-42826968 GCATTGGAAGAAATGGGTTGGGG + Intergenic
977835985 4:101646980-101647002 GCAGTGGAACAGGTGGGTAGTGG + Intronic
999510737 5:152248792-152248814 GCATTGGAAGAGATGGGTGTGGG + Intergenic
1001622564 5:173100722-173100744 GCATGAAAACATATGGGTTGGGG - Intronic
1003049988 6:2771337-2771359 GCATTGAAACATTTGGCCCGTGG + Intronic
1019784250 7:2964363-2964385 GCATTGCAAAAGATGGAACGTGG - Intronic
1022980364 7:35599897-35599919 GGATTAAAACTGATGGGTCATGG + Intergenic
1024964455 7:55010246-55010268 CCATTGTAACAGATGTGTAGTGG + Intergenic
1035000510 7:155609001-155609023 CCTGGGAAACAGATGGGTCGAGG + Intergenic
1035942189 8:3913641-3913663 GCATTGAGACATTTGGGTCAGGG + Intronic
1048155138 8:131940160-131940182 GGATTGCAACAGGTGGGTGGGGG + Intronic
1049989590 9:978246-978268 GGATGGAAACGGATGGGTGGTGG - Intronic
1051331308 9:16027394-16027416 GCACTGATACAGCTGGGTGGAGG + Intronic
1057874780 9:98745601-98745623 GAATTAAGACAGATGGGTCCAGG - Exonic
1186901685 X:14064204-14064226 ACCTTGAAACAGAAGGGTCATGG - Intergenic
1194167328 X:90534267-90534289 GCATTGAAACTGCTGGTTCTTGG - Intergenic
1194846227 X:98812601-98812623 GCATTCAAAAAGAAGGGTGGAGG - Intergenic
1200513591 Y:4112042-4112064 GCATTGAAACTGCTGGTTCTTGG - Intergenic