ID: 1069288475

View in Genome Browser
Species Human (GRCh38)
Location 10:66746129-66746151
Sequence ACCGAAGACAGCCAGAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 288}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069288475_1069288479 13 Left 1069288475 10:66746129-66746151 CCATCTCTCTGGCTGTCTTCGGT 0: 1
1: 0
2: 1
3: 35
4: 288
Right 1069288479 10:66746165-66746187 ACAAAGTTGGTTTTGCCATTGGG No data
1069288475_1069288478 12 Left 1069288475 10:66746129-66746151 CCATCTCTCTGGCTGTCTTCGGT 0: 1
1: 0
2: 1
3: 35
4: 288
Right 1069288478 10:66746164-66746186 AACAAAGTTGGTTTTGCCATTGG No data
1069288475_1069288477 0 Left 1069288475 10:66746129-66746151 CCATCTCTCTGGCTGTCTTCGGT 0: 1
1: 0
2: 1
3: 35
4: 288
Right 1069288477 10:66746152-66746174 CCAATCAGACGTAACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069288475 Original CRISPR ACCGAAGACAGCCAGAGAGA TGG (reversed) Intronic
901643125 1:10703108-10703130 AAAGAGGACAGCAAGAGAGACGG + Intronic
902526022 1:17058098-17058120 TCAGGAGACAGCCAGGGAGACGG - Intergenic
903064982 1:20694535-20694557 ACTGTAGTAAGCCAGAGAGAGGG + Intronic
903571923 1:24311958-24311980 ACAGGAGGCAGCCAGGGAGAGGG - Intergenic
903599421 1:24524551-24524573 GACTAAAACAGCCAGAGAGATGG - Intronic
903681402 1:25099753-25099775 ACATAAGACAGTCAGAGAGTGGG + Intergenic
904043562 1:27597777-27597799 AACCCAGACAGACAGAGAGAGGG - Intronic
904043596 1:27598026-27598048 AACACAGACAGCCAGACAGATGG - Intronic
904745775 1:32709860-32709882 ACAGATCACAGCCAGATAGAGGG + Intergenic
904813094 1:33176543-33176565 ACCTGAGACGGCCAGAGAGCCGG + Intronic
904873980 1:33639442-33639464 ACAGAATTCTGCCAGAGAGAAGG - Intronic
907073776 1:51560749-51560771 AAAGAAGACTGGCAGAGAGAGGG + Intergenic
908314798 1:62922235-62922257 ATGGAATACAGCCAGAGAGAGGG + Intergenic
908536201 1:65079954-65079976 ATCAAAGGCAACCAGAGAGAAGG - Intergenic
908775473 1:67635352-67635374 ACTAAAGACAGGGAGAGAGACGG + Intergenic
909162613 1:72172877-72172899 ACCAGAGAGAACCAGAGAGATGG - Intronic
910100274 1:83568288-83568310 ACCCAGGACAGCCAGAGTCAGGG - Intergenic
910435755 1:87203916-87203938 TCCGCTGCCAGCCAGAGAGAAGG - Intergenic
910529832 1:88223190-88223212 AACAAAGACAACCAGAGAGTGGG - Intergenic
914918699 1:151833409-151833431 AGCAAAGAGAGACAGAGAGATGG - Intergenic
915469930 1:156119757-156119779 ACAGAAGACAGCAGGAGACAGGG + Intronic
915704246 1:157828606-157828628 TCAGAAGACCCCCAGAGAGATGG + Intergenic
916486884 1:165267610-165267632 AAGGAAGAAAGCCAGTGAGAAGG + Intronic
916505299 1:165423126-165423148 CCCCAAGCCAGCCAGAGAGATGG - Intronic
916530688 1:165653579-165653601 ACAGAAGACAGCATGTGAGAAGG - Intronic
917131068 1:171742395-171742417 AACGTAGTCAGCCAGAGGGACGG - Intergenic
919500869 1:198336820-198336842 ACTGCAGAGAACCAGAGAGATGG - Intergenic
922001061 1:221478749-221478771 GCTGAAAAGAGCCAGAGAGAAGG - Intergenic
923897054 1:238282851-238282873 AAGGAAAACAGCGAGAGAGAAGG - Intergenic
924736791 1:246764548-246764570 TCCAAAAACAGCCAGAGGGAGGG - Intronic
1066978835 10:42392679-42392701 GAGGAAGACAGACAGAGAGAAGG + Intergenic
1067259032 10:44670079-44670101 ACAGAAGACAGCAAGAGAGGAGG + Intergenic
1069288475 10:66746129-66746151 ACCGAAGACAGCCAGAGAGATGG - Intronic
1070587352 10:77776604-77776626 AGTGATGTCAGCCAGAGAGAAGG + Intergenic
1072578698 10:96721812-96721834 ACAGAAGAGAGTCAGAGAAAGGG - Intergenic
1072633971 10:97165574-97165596 GCAGCAGACAGCCAGAGAGTCGG + Intronic
1073027538 10:100498843-100498865 ACCCAAGACAGACAGAGAGCTGG + Intronic
1073043619 10:100623518-100623540 GGCGAAGACAGACACAGAGATGG + Intergenic
1073206235 10:101770856-101770878 AACGCAGAAAGACAGAGAGAGGG + Intronic
1076529708 10:131136206-131136228 GCAGAAGGCAGCCAGAGAGGAGG - Intronic
1077154738 11:1086224-1086246 ACTGGGGACAGCCAGAGAGTGGG - Intergenic
1077507710 11:2939798-2939820 GCCACAGACACCCAGAGAGATGG - Intergenic
1077737172 11:4803742-4803764 ATCAAAGCCAGCCACAGAGAAGG + Exonic
1078157351 11:8810449-8810471 CCAGAAAACAGCCGGAGAGAAGG + Intronic
1078387004 11:10901167-10901189 GCCTCAGAAAGCCAGAGAGAAGG - Intergenic
1078815144 11:14813447-14813469 ACATAAAAGAGCCAGAGAGATGG - Intronic
1079336745 11:19576889-19576911 GCCTAAGACAGCCAGATGGAAGG - Intronic
1080751089 11:35151102-35151124 AAAGAAGATAGACAGAGAGAGGG + Intronic
1080897771 11:36460644-36460666 AGCGAGGAAAGCCAGGGAGAAGG - Intronic
1081212826 11:40357175-40357197 ACCAAAGTCAGCCAAAGATAGGG + Intronic
1081293199 11:41351576-41351598 ACTGAAGGCAGCTAGAGAAAAGG + Intronic
1081636348 11:44725041-44725063 ACCAGAGACAGGCAGAGAGAGGG - Intergenic
1083738041 11:64692966-64692988 ATCAAAATCAGCCAGAGAGAAGG + Intronic
1083947740 11:65934209-65934231 ACAGAAGCCAGAAAGAGAGAAGG + Intergenic
1086392545 11:86380352-86380374 AAAGAAGCCAGGCAGAGAGAGGG - Intronic
1086452866 11:86934361-86934383 ACCAAAGAGAGAGAGAGAGATGG - Intronic
1088765600 11:112972930-112972952 ACGGAAAAGAGCCAGAGGGAGGG + Intronic
1088981924 11:114871771-114871793 TCCTAAGAGAGCCAGAGAGTGGG + Intergenic
1090104565 11:123838574-123838596 ACCAAAGTCAGCAAGAGTGAAGG - Intergenic
1090167119 11:124561348-124561370 ACCAGAGACAGCAAGAGAAAGGG - Intergenic
1091830418 12:3545364-3545386 ACCAAAGACAACAAGACAGATGG - Intronic
1091859455 12:3766850-3766872 CTCTAAGACAGGCAGAGAGAGGG + Intergenic
1092875317 12:12842628-12842650 AGAGAAGTCAGCAAGAGAGAAGG - Intergenic
1095398933 12:41792394-41792416 ACTGTAGAGAGACAGAGAGATGG - Intergenic
1095698224 12:45164697-45164719 CCTGAAGACAGCCAGAGTGAGGG + Intergenic
1095719392 12:45384579-45384601 CCAGAAGAGAGGCAGAGAGATGG + Intronic
1095899923 12:47317584-47317606 ACCGCACCCAGCCAGAAAGAAGG + Intergenic
1097693229 12:62753757-62753779 AATGGAGAAAGCCAGAGAGAGGG - Intronic
1097749138 12:63332310-63332332 ATTAAGGACAGCCAGAGAGAAGG + Intergenic
1097896206 12:64826164-64826186 ACAGAATACGGGCAGAGAGAAGG - Intronic
1098934354 12:76461206-76461228 ACAGAATACAGCCAAAGTGATGG + Intronic
1099572857 12:84347373-84347395 ATCAAAGGCAGCTAGAGAGAAGG - Intergenic
1099877873 12:88431625-88431647 ACCAAACACAGGCAGAGATATGG + Intergenic
1100126833 12:91437044-91437066 ACCAAAGACAGACAGACACATGG - Intergenic
1101569459 12:105939766-105939788 ACCCAGGAAAGCCAGACAGAGGG + Intergenic
1102216938 12:111168341-111168363 ACAGGTGACAGGCAGAGAGAAGG - Intronic
1103058821 12:117842677-117842699 AGAGATGACAGCCAGAGAGTCGG + Intronic
1103360669 12:120351580-120351602 ACAGAGGAGAGACAGAGAGAGGG + Intronic
1104013846 12:124949716-124949738 ACTAAAGACACACAGAGAGATGG + Intronic
1105827795 13:24137857-24137879 ACCAAGGAGAGTCAGAGAGATGG + Intronic
1106804178 13:33289309-33289331 ACCAAAGACAGCAAAAGAGAAGG + Intronic
1106859753 13:33893058-33893080 ACTGAGGACAGGCCGAGAGAAGG + Intronic
1107891520 13:44918613-44918635 ACCGAAAGCAGCCAGAGTGGCGG + Intergenic
1110034277 13:70660023-70660045 TCCCAAGGCAGCCATAGAGAAGG + Intergenic
1113002238 13:105654656-105654678 ACCAAAGATAACCAGAGATAAGG + Intergenic
1114567345 14:23642514-23642536 ACTGAAGACAGCCTGATGGAGGG - Intronic
1118784793 14:69037228-69037250 ACAAAAAACAGCCTGAGAGAAGG + Intergenic
1119354800 14:73997213-73997235 AATAAAGACAGCCAGAGTGAGGG + Intronic
1119847356 14:77840442-77840464 GCAGAAGAGAGCCAGGGAGATGG - Intronic
1120653443 14:87161692-87161714 ACCTAAGATAGCCAGAGTGAGGG + Intergenic
1121940783 14:98068604-98068626 ACCGATGACAGCAAGAGGTAGGG + Intergenic
1122255176 14:100471168-100471190 TCCCAAGCCAGCCAGGGAGAGGG - Intronic
1202878495 14_KI270722v1_random:33907-33929 ACCCAAGAAATCCAGACAGAAGG + Intergenic
1124029254 15:25994736-25994758 AACAAAGAAAGTCAGAGAGAGGG + Intergenic
1127124853 15:55801954-55801976 ACAGATGACAGCCTGAGAGGGGG - Intergenic
1127284201 15:57518292-57518314 ACCGAAGACACCCATAGATATGG - Intronic
1128419479 15:67478072-67478094 ACTGAAGACAGCTACAGAAAAGG + Intronic
1129362250 15:75031206-75031228 CCCAAAGGCAGCCTGAGAGAAGG + Intronic
1129458970 15:75690417-75690439 AGGGAAGGCAGCCAGAGAGTGGG + Exonic
1129724839 15:77896475-77896497 AGGGAAGGCAGCCAGAGAGTGGG - Intergenic
1130245818 15:82247653-82247675 TCAGAAGACAGCCAGGCAGAAGG + Intronic
1130454882 15:84095727-84095749 TCAGAAGACAGCCAGGCAGAAGG - Intergenic
1131693575 15:94852922-94852944 ACCGAAGGTAGCTAGAGAGAAGG - Intergenic
1131768189 15:95703559-95703581 ACAGAAAACAGCCACAAAGATGG - Intergenic
1133283152 16:4678314-4678336 CCCAAAGACAGACAGAGACATGG + Intronic
1133678693 16:8099833-8099855 ACTGAAGAGAGAGAGAGAGAAGG - Intergenic
1134407461 16:13973879-13973901 ACAGCAGAGAGCCAGAGAGCTGG + Intergenic
1135122139 16:19775390-19775412 TACGAAGACAGACAGACAGAAGG - Intronic
1135179146 16:20257769-20257791 CCCAAAGTCAGCCAGAGAGAGGG - Intergenic
1137270802 16:46901251-46901273 ACTGAAGAAAGCCAGAGAAAGGG - Intronic
1137904765 16:52310003-52310025 CCAGAAGACAGAGAGAGAGAGGG + Intergenic
1137936025 16:52636384-52636406 GCAGAAGAGAACCAGAGAGATGG - Intergenic
1138759920 16:59531071-59531093 ACAGAAGAGAGCCAGAAAGATGG - Intergenic
1140996445 16:80264319-80264341 ACAGAAGACAGAGAGAGAGAGGG - Intergenic
1142110147 16:88326970-88326992 ACCAAAGACAGACAGACAGGAGG - Intergenic
1142758401 17:2029100-2029122 AGAGAAGACAGCCAGTGAGACGG - Intergenic
1143117117 17:4587339-4587361 ACGGAGGACAGCAAGAGAGATGG - Intronic
1143188526 17:5024537-5024559 ACCACAGACAGACAGACAGACGG - Exonic
1143216270 17:5227561-5227583 ACTGAATAGAACCAGAGAGAAGG + Intronic
1146815196 17:35936866-35936888 ACAGAAGACAGCCCCAAAGATGG + Intronic
1147920255 17:43911962-43911984 ACAGCAGACAGCCAGAGATAAGG - Intergenic
1148229180 17:45920565-45920587 ACTGAACACAGCCACAGAGTTGG - Intronic
1150533598 17:66012637-66012659 ATTAAAGACAGCTAGAGAGAAGG - Intronic
1150940402 17:69687062-69687084 ACTAAAGACAGCTAGAGAGAAGG - Intergenic
1150995179 17:70308893-70308915 ACCTAAAACAGCAAGAGAGGAGG + Intergenic
1151895117 17:76974871-76974893 ACAGCAGAAAGCCAGAGAGTGGG - Intergenic
1152061336 17:78077980-78078002 CCCTAAGAAAGTCAGAGAGAAGG - Intronic
1152747581 17:82048508-82048530 AACGAAGACAGCCAGGCTGATGG - Exonic
1155489735 18:26388722-26388744 AGCGAAGGAAGCCAGAGTGATGG + Intronic
1155507659 18:26548541-26548563 CCCGAGGACTGGCAGAGAGACGG - Intronic
1156406782 18:36790387-36790409 ACTGAAAGCATCCAGAGAGATGG + Intronic
1157717334 18:49897057-49897079 ACCCCAGACAGCCAGAGACTCGG - Intronic
1158880151 18:61770336-61770358 GACGAAGAGAACCAGAGAGATGG + Intergenic
1161600421 19:5179069-5179091 ACCTAGGGCACCCAGAGAGATGG - Intronic
1163113531 19:15175992-15176014 GCCTAGGACAGACAGAGAGAGGG + Intronic
1164961843 19:32438745-32438767 ACCAAAGAAATACAGAGAGAGGG + Intronic
1166168546 19:41009907-41009929 ACGGAGGGCAGCCAGGGAGATGG + Intronic
925685573 2:6469412-6469434 ACCTAAGACAAGCAGAAAGAAGG - Intergenic
925907491 2:8547989-8548011 ACTGCAGACAGCCAGGGGGATGG - Intergenic
926608054 2:14917404-14917426 ATCAAAGCCAGCCAGAGACAGGG + Intergenic
927756469 2:25712291-25712313 ACAGGAGACAGTCAGAGAAATGG + Intergenic
927862071 2:26566250-26566272 ACCCCAGGCAGACAGAGAGAGGG - Intronic
928273030 2:29874210-29874232 AGAGAAGAAAGCCATAGAGAAGG - Intronic
928609158 2:32975285-32975307 ATTAAAGACAGCCAGAGAGAAGG - Intronic
928631171 2:33193846-33193868 CCTGAAGACAGGGAGAGAGATGG - Intronic
932603920 2:73151060-73151082 AGCAAAGACAGACAGGGAGATGG + Intronic
933977095 2:87520414-87520436 TCCAAAGACAGACAGAGGGACGG - Intergenic
934131517 2:88953410-88953432 ACCGTACAGAGACAGAGAGAGGG - Intergenic
934591138 2:95551083-95551105 ACAGGAGACAGTCAGAGAAATGG - Intergenic
935597498 2:104890601-104890623 ACCCAGGATAGCCACAGAGAAGG - Intergenic
936229039 2:110683298-110683320 ACTGGAGACAGGGAGAGAGATGG + Intergenic
936316722 2:111430391-111430413 TCCAAAGACAGACAGAGGGACGG + Intergenic
936979800 2:118253920-118253942 ACCAAAGACAGCAAATGAGAAGG + Intergenic
938400436 2:130986809-130986831 AAAGAAGGCAGCCAGAGAAAGGG - Intronic
939939363 2:148330301-148330323 ACTGTAGACAGAGAGAGAGAAGG + Intronic
940515704 2:154681628-154681650 ATCCAAGACAGCAAGAGGGAAGG - Intergenic
941008502 2:160271014-160271036 ACATAACACAGCCAGATAGAGGG + Intronic
941881879 2:170489183-170489205 AGAGGAGAAAGCCAGAGAGAAGG - Intronic
941960196 2:171245786-171245808 ACCCAAGACAGCCAAGCAGAAGG - Intergenic
942328874 2:174800649-174800671 AGCAAAGACAGCCAGAGTGAAGG - Intronic
944306651 2:198187178-198187200 ACCAAAGACCACCATAGAGAAGG - Intronic
944381017 2:199110949-199110971 ATGGAAGACGGCCTGAGAGATGG - Intergenic
945149900 2:206779522-206779544 ACAGAAGAGAGCAAGAGAAAGGG + Intronic
945504396 2:210620645-210620667 GCAGGAGCCAGCCAGAGAGAGGG + Intronic
946104800 2:217359792-217359814 ACCGAAGGCAGCCAGACACCAGG + Intronic
946726438 2:222665987-222666009 AGAGAAGACAGAGAGAGAGAGGG + Intergenic
948718591 2:239882080-239882102 TCCCAAGACAGCCAGAGAAGGGG + Intergenic
948752670 2:240141528-240141550 ACCAAAGATACCCAGAGAGGTGG + Intronic
1168972299 20:1939003-1939025 ATTGAAGACAGCCAGGGGGATGG + Exonic
1170158350 20:13288517-13288539 CTGGAAGACAGCCAGGGAGATGG - Intronic
1170289452 20:14752006-14752028 AACAAAGGCAGCCAGAGGGATGG - Intronic
1170837773 20:19899746-19899768 ACAGGAGAGAGCAAGAGAGATGG + Intronic
1171061655 20:21969896-21969918 ACCGAAAGCAGCAAGGGAGATGG - Intergenic
1171867943 20:30502747-30502769 ACAGAAGACAGGCACAGACAGGG + Intergenic
1171877995 20:30596288-30596310 ACTGAAGCCAGGCAAAGAGATGG + Intergenic
1172706166 20:36883640-36883662 CCCGAATATAGACAGAGAGAAGG - Intronic
1173897491 20:46562028-46562050 AATAAAGACAGCCAGAGAAATGG - Intronic
1175336824 20:58201745-58201767 ACCGAAGACAGACAATGACACGG + Intergenic
1176237798 20:64062330-64062352 ACTGCAGGCAGCCAGAGAGATGG - Intronic
1177104856 21:16943134-16943156 TCTGAAGACAGCCAGAGACAAGG - Intergenic
1177200524 21:17949725-17949747 AGTGAAGTGAGCCAGAGAGATGG + Intronic
1177905212 21:26965951-26965973 GTCAAAGACAGCCAGAGAGCGGG + Exonic
1178269944 21:31180403-31180425 AAGGAAAACAGCCAGAGACAAGG + Intronic
1179273534 21:39869882-39869904 ACCAAAGAAAGCCAGAGCAATGG + Intronic
1179475333 21:41639575-41639597 ACAGTAGAGAGCCAGAGAGCTGG - Intergenic
1179826849 21:43971111-43971133 ACAGAAAACAGCCAGACAGCAGG + Intronic
1180711594 22:17842830-17842852 ACCGCACCCAGCCAGAGTGATGG - Intronic
1182178370 22:28317679-28317701 AAGGAAGACAGTCAGAGAGCTGG - Intronic
1184343570 22:43899486-43899508 ACCCAAGACAGGCAAGGAGAGGG - Intergenic
1184811485 22:46836541-46836563 ACAGAAGACGGCAAGAGAGGAGG + Intronic
1184877588 22:47285282-47285304 GAAGAAGACAGGCAGAGAGATGG - Intergenic
1185013589 22:48330911-48330933 AATGGAAACAGCCAGAGAGATGG - Intergenic
1185121365 22:48973640-48973662 ACCCAGCACAGCTAGAGAGAGGG - Intergenic
1185233993 22:49700455-49700477 ATCAAAGAGAGACAGAGAGAGGG - Intergenic
951545804 3:23823864-23823886 TCTGAAGACTTCCAGAGAGAGGG - Intronic
951767224 3:26213644-26213666 ACTAAAGGCAGCTAGAGAGAAGG - Intergenic
956062237 3:65359174-65359196 ACCAAGAACAGTCAGAGAGAAGG + Intronic
956942185 3:74176003-74176025 ACCCAAGACAGGGAGAAAGATGG + Intergenic
957085180 3:75670910-75670932 ACCGAAGGCAGACAGAAAAACGG + Intergenic
957679239 3:83410318-83410340 ACTGATGAGAGCAAGAGAGATGG + Intergenic
958768013 3:98394460-98394482 ACACAAGTCAGCCAAAGAGAAGG + Intergenic
959029515 3:101281767-101281789 ACAGAAGAAAGTCAGAGTGACGG + Intronic
960754810 3:121000017-121000039 ATTAAAGACAGCTAGAGAGAAGG - Intronic
961629040 3:128282914-128282936 CCGGAAGTCAGCCAGAGTGAGGG + Intronic
963388819 3:144631862-144631884 AAAGAAGAGAGCCAGAGAAATGG + Intergenic
965758920 3:172054205-172054227 ACCCAAGGCAGCCACAGGGATGG + Intronic
966945623 3:184775261-184775283 ACAGTAGACAGCAAGAGACACGG - Intergenic
968565932 4:1312826-1312848 ACTGAAGACACCCAGAAAGTGGG + Intronic
968627955 4:1636596-1636618 ACCCAGGACAGCCAGTGTGAAGG - Intronic
969560821 4:7946766-7946788 ACAGAAGACAGCAAAAGTGATGG - Intergenic
973329154 4:48895008-48895030 ACTGGTGACAGGCAGAGAGATGG + Intronic
974567799 4:63600928-63600950 AAAGAAGACAGGTAGAGAGAGGG - Intergenic
975135820 4:70873415-70873437 TCCGAAGACAGCAGGAGTGAAGG - Intergenic
975516660 4:75255317-75255339 ACCGAAGAAAGGCAGCAAGAGGG - Intergenic
975861879 4:78686143-78686165 CCCAAAGACAGCCACAGATATGG + Intergenic
976015202 4:80543933-80543955 TCTTAAGACAGCTAGAGAGAAGG + Intronic
976194924 4:82523208-82523230 CCCGTACACAGCCAGAGGGATGG + Intronic
976803767 4:89022764-89022786 ACATCAGACAGACAGAGAGAGGG - Intronic
977152794 4:93534034-93534056 ACAGAAAACAGCCAGTGAAAAGG - Intronic
977416127 4:96734412-96734434 GCCGAAGAGAGAGAGAGAGAAGG - Intergenic
983054427 4:163085110-163085132 ACCGAAGACACCCAGAGTACTGG - Intergenic
984594957 4:181656280-181656302 ACAGAAGCCAGCCAAAGAAAGGG + Intergenic
985526312 5:404355-404377 ACTGAAGACACCCAGAATGAAGG - Intronic
986042303 5:4005390-4005412 ACCCAAAACAGACAGAAAGAGGG - Intergenic
986150800 5:5129000-5129022 ACAGAAGAAAGAGAGAGAGAGGG - Intergenic
986529530 5:8721687-8721709 ACTGTGGTCAGCCAGAGAGATGG + Intergenic
986620545 5:9668493-9668515 GTTAAAGACAGCCAGAGAGAAGG + Intronic
989323943 5:40167853-40167875 ACCGAAGACAAAAAGAGAGAAGG + Intergenic
991611620 5:68455476-68455498 TCCAAAGACAGCCAAAGAGAAGG + Intergenic
992004738 5:72466278-72466300 AGCAAAAACAGCCATAGAGAAGG - Intronic
997760460 5:136443789-136443811 ATTGAAAACAGCCAGAGAGAGGG - Intergenic
998544368 5:143014092-143014114 AACAAAGACAGCCAGAGTGAAGG + Exonic
999220523 5:149972808-149972830 AACGAAGACAGCCAGTAAGATGG - Intronic
999813335 5:155149993-155150015 AAGGAAGAGAGACAGAGAGAAGG + Intergenic
1000096752 5:157978097-157978119 AAGAAAGAGAGCCAGAGAGAAGG + Intergenic
1000349567 5:160342756-160342778 ACTGAGTCCAGCCAGAGAGATGG + Intronic
1002091471 5:176809300-176809322 ACAAAAGACAGACCGAGAGAGGG + Intergenic
1003022474 6:2522828-2522850 TCAGGAGACAGCAAGAGAGAAGG - Intergenic
1003876364 6:10441246-10441268 ACCCTAGAAAGCCAGAGAGCTGG + Intergenic
1003918022 6:10805858-10805880 AAAGAAGGCAGACAGAGAGATGG - Intronic
1004764384 6:18709139-18709161 AACCAAGACAACCAGACAGATGG - Intergenic
1004972241 6:20923584-20923606 AAGAAAGACAGACAGAGAGAGGG - Intronic
1005119107 6:22370779-22370801 ACATAAGACACACAGAGAGAAGG - Intergenic
1006037481 6:31224869-31224891 AGGGAAGACACCCAGAGGGAGGG + Intergenic
1007168459 6:39845654-39845676 ACTAAAGACAGGAAGAGAGAGGG - Intronic
1007301821 6:40873395-40873417 AGAGAAGACAGAGAGAGAGAAGG - Intergenic
1009942181 6:70302701-70302723 ACCGAAGACAGACAGAGGAAGGG - Intronic
1011251292 6:85375077-85375099 ACCTAAGACAGCCTGATAGATGG - Intergenic
1011303582 6:85902062-85902084 ACCTCAGACAGCCTGGGAGAAGG + Intergenic
1012101980 6:95101401-95101423 ACTGAAGAAAAACAGAGAGAAGG - Intergenic
1012947112 6:105478734-105478756 CCTGAAGACACACAGAGAGAAGG + Intergenic
1013660417 6:112290256-112290278 AACAAAGACATCAAGAGAGATGG - Intergenic
1015377074 6:132523365-132523387 ACAGACAACAGCTAGAGAGATGG - Intergenic
1016277146 6:142367535-142367557 ACAAAAGAGAGACAGAGAGAAGG - Intronic
1017131290 6:151110499-151110521 TCTGCAAACAGCCAGAGAGATGG + Intergenic
1017495145 6:154977214-154977236 TGCCAAGACAGCCAGAGAGAAGG - Intronic
1017538394 6:155373176-155373198 AGAGAAGAAAGACAGAGAGAGGG - Intergenic
1019433276 7:1009485-1009507 GCCGCAGGCAGCCAGGGAGATGG + Intronic
1019438509 7:1034103-1034125 ACCGCAGACAGTCAGGGAGCTGG + Intronic
1019516771 7:1443632-1443654 GGAGAAGACAGACAGAGAGAAGG + Intronic
1021022991 7:15627041-15627063 ACCAAAGACAGCAAGACTGACGG + Intronic
1023174303 7:37420847-37420869 TCCGAAGAGAGCCAGCAAGATGG - Intronic
1023610509 7:41966332-41966354 AGCGAAGCCAGCCAGAGCGACGG - Exonic
1024245019 7:47462875-47462897 ACAGAAGGCAGCCAGAAAGTGGG + Intronic
1024519925 7:50296768-50296790 ACCAATGAAAACCAGAGAGAAGG + Intergenic
1026515404 7:71065728-71065750 ACCGCAGACCACCAGACAGAAGG + Intergenic
1027129875 7:75583166-75583188 AGCAAAGGCAGGCAGAGAGATGG - Intronic
1027731690 7:81882501-81882523 ACTGAAGACAGCCACAAAGATGG + Intergenic
1028064942 7:86372084-86372106 ACCGAGGAGAGTGAGAGAGATGG - Intergenic
1028302077 7:89212693-89212715 ACCTAAGACAACCTAAGAGAGGG - Intronic
1028344849 7:89767122-89767144 ACTGAAAACAGGGAGAGAGATGG - Intergenic
1028488014 7:91381202-91381224 ACCCAAGTCAACCAGAGGGAAGG + Intergenic
1033374084 7:140740622-140740644 AGGGAGGACAGCCTGAGAGAAGG + Intronic
1033461169 7:141548859-141548881 AATGCACACAGCCAGAGAGAAGG - Intergenic
1034043132 7:147900156-147900178 AACGAAGGCAGCCAGGGTGATGG - Intronic
1034861285 7:154597166-154597188 AGAGAAGACAGAGAGAGAGAGGG + Intronic
1035596165 8:859646-859668 ACCGAAGGCAGCCAGAGGCCTGG - Intergenic
1035718390 8:1771468-1771490 ACCCAAGAAAGGCAAAGAGATGG - Exonic
1038577924 8:28721342-28721364 ACAGGAGAAAGCCAGAGAGAGGG - Intronic
1038859708 8:31374211-31374233 ATTGAAGGCAGCTAGAGAGAAGG - Intergenic
1040917203 8:52574539-52574561 ACCGAAGAAAGAAAGAAAGAGGG + Intergenic
1041466129 8:58159278-58159300 CCAGAAGGCAGCCAGCGAGAGGG + Intronic
1041567333 8:59293908-59293930 ATGGAAGACAGCCATAAAGATGG - Intergenic
1042763671 8:72297613-72297635 ACCGAAAGTGGCCAGAGAGATGG - Intergenic
1045466007 8:102470437-102470459 ACATAAGAAACCCAGAGAGATGG + Intergenic
1048523590 8:135180140-135180162 ACCTCAGAGAGCCAGAGACATGG + Intergenic
1048563259 8:135565669-135565691 AAGGAAGAGAGCCAGAGATAGGG - Intronic
1049278974 8:141734553-141734575 GCAGAAAACAGCCAGAGTGAAGG + Intergenic
1049356409 8:142191115-142191137 GCCAGAGAGAGCCAGAGAGAGGG - Intergenic
1049961958 9:745416-745438 ACAGAAGACGGCCAGAAAGGAGG - Exonic
1051132454 9:13877431-13877453 ACAGAACACAGCCAGAGAGAAGG - Intergenic
1051468662 9:17409402-17409424 ACAGAAGACAGCCAAACACAAGG + Exonic
1052356382 9:27509286-27509308 AAGGAAGACAGGGAGAGAGAGGG + Intronic
1053156658 9:35785627-35785649 ACTGGAGAGACCCAGAGAGAAGG + Intergenic
1055425632 9:76193209-76193231 CCAGAAGTCAGCAAGAGAGAAGG - Intronic
1057006105 9:91561462-91561484 ACAGAAAAGAGCCAGAGGGACGG + Intergenic
1057749784 9:97782743-97782765 ACAGAAGGAAGACAGAGAGAGGG - Intergenic
1058153167 9:101484251-101484273 AAAGAAGACAGAAAGAGAGAAGG + Intronic
1058849515 9:108997360-108997382 AATGAGGACAGCCTGAGAGAAGG - Intronic
1060027651 9:120186503-120186525 GCCAAACACACCCAGAGAGAGGG + Intergenic
1061549200 9:131323483-131323505 ACCGCACCCAGCCAGAGACAGGG + Intergenic
1062566890 9:137167559-137167581 CCCGCAGACAGACAGACAGACGG + Intronic
1062689303 9:137833273-137833295 ACAGACGACAGCCAGGCAGACGG - Intronic
1188145148 X:26602793-26602815 ATTGAAGACAGACAGACAGACGG - Intergenic
1188469141 X:30517680-30517702 CCCGAAGAGAGGGAGAGAGATGG - Intergenic
1189061116 X:37754576-37754598 ACTGAAGTCACCCAGAAAGATGG - Intronic
1189102517 X:38206193-38206215 ACTGCAGAGAGGCAGAGAGAGGG + Intronic
1189860021 X:45262461-45262483 AGAGAAGAGAGCAAGAGAGAGGG + Intergenic
1189984469 X:46541961-46541983 ACAGAAAACAGCCAGAGAAGAGG + Intronic
1190275506 X:48896804-48896826 ACCGATGACACCCATAGTGAAGG + Exonic
1190932550 X:54961736-54961758 ACGGAAGACAGTGAGAGAGAAGG + Intronic
1192606204 X:72521289-72521311 TCCAAAGACAGCGAGAGAGAGGG - Intronic
1193827707 X:86246399-86246421 ATTAAAGACAGCTAGAGAGAAGG + Intronic
1195172740 X:102284993-102285015 ACTAAAAGCAGCCAGAGAGAAGG - Intergenic
1195186126 X:102402102-102402124 ACTAAAAGCAGCCAGAGAGAAGG + Intronic
1195273923 X:103260348-103260370 ACCAAAGGCATCCAAAGAGAAGG + Intergenic
1195319168 X:103707305-103707327 AGGGAAGACAGCCCGGGAGATGG + Exonic
1197014077 X:121603288-121603310 ATGAAAGACAGCTAGAGAGAAGG - Intergenic
1197106833 X:122726836-122726858 ATTAAAGACAGCTAGAGAGAAGG + Intergenic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic
1199769661 X:150966471-150966493 CCTGCAGACAGCCAGAGAAAAGG - Intergenic
1200404742 Y:2798451-2798473 ACCGCACTCAGCCAGAGACAAGG - Intergenic
1200562365 Y:4720773-4720795 ACTAAAGGCAGCTAGAGAGAAGG - Intergenic
1202369962 Y:24189673-24189695 AGGGAAGGCAGCCAGAGAGTGGG + Intergenic
1202500822 Y:25480444-25480466 AGGGAAGGCAGCCAGAGAGTGGG - Intergenic