ID: 1069289192

View in Genome Browser
Species Human (GRCh38)
Location 10:66756151-66756173
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069289191_1069289192 -10 Left 1069289191 10:66756138-66756160 CCTTTGACACAATGATCTGACTA 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1069289192 10:66756151-66756173 GATCTGACTAGACCAATAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr