ID: 1069293963

View in Genome Browser
Species Human (GRCh38)
Location 10:66820284-66820306
Sequence ATCCACTTTCTGTACTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069293963_1069293965 -10 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293965 10:66820297-66820319 GAAAGTGGATTAGTGGCTGCTGG No data
1069293963_1069293969 -2 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293969 10:66820305-66820327 ATTAGTGGCTGCTGGGGGTGAGG No data
1069293963_1069293966 -9 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293966 10:66820298-66820320 AAAGTGGATTAGTGGCTGCTGGG No data
1069293963_1069293970 -1 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293970 10:66820306-66820328 TTAGTGGCTGCTGGGGGTGAGGG No data
1069293963_1069293971 19 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293971 10:66820326-66820348 GGGTAAGAAATTGAAGTGACTGG No data
1069293963_1069293967 -8 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293967 10:66820299-66820321 AAGTGGATTAGTGGCTGCTGGGG No data
1069293963_1069293968 -7 Left 1069293963 10:66820284-66820306 CCTATAAAGTACAGAAAGTGGAT 0: 1
1: 0
2: 0
3: 14
4: 221
Right 1069293968 10:66820300-66820322 AGTGGATTAGTGGCTGCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069293963 Original CRISPR ATCCACTTTCTGTACTTTAT AGG (reversed) Intronic
901963603 1:12847705-12847727 ATCCACTTTCTGTTTTATCTGGG + Exonic
901984293 1:13061887-13061909 ATCCACTTTCTGTTTTATCTGGG - Exonic
901991245 1:13115816-13115838 ATCCACTTTCTGTTTTATCTGGG + Intergenic
901997517 1:13164883-13164905 ATCCACTTTCTGTTTTATCTGGG + Exonic
902063355 1:13663988-13664010 ATCCACTTTCCATACATTAAAGG - Intergenic
902177354 1:14660796-14660818 AGCCACTTTCTGTTCGTCATTGG - Intronic
906217754 1:44053818-44053840 ATCCACTTGTTGTACTGTAGAGG + Intergenic
906721459 1:48008328-48008350 ATGCACTTTGTGTACTGTAAAGG + Intergenic
907207831 1:52790209-52790231 ATCTACTTTCTTTAATTTAGTGG + Intronic
907312008 1:53544215-53544237 ATCTATTTTCTGTAAATTATTGG - Intronic
907700363 1:56780602-56780624 AAGCACTTACTGTACTTCATGGG + Intronic
909903470 1:81167298-81167320 ATCCACTTGCTGTACTATCTAGG - Intergenic
910465525 1:87495075-87495097 ATCCACTTCCTGTACCTGATGGG + Intergenic
911428981 1:97758995-97759017 CAACACTTTGTGTACTTTATTGG - Intronic
911879745 1:103221154-103221176 ATGCACTTTCTGATCTTTAATGG + Intergenic
913377638 1:118171370-118171392 GGCCATTTTCTGTACTTTTTTGG + Intronic
914360335 1:146930165-146930187 ATCCACTTCCTGTACCTGATGGG + Intergenic
914493411 1:148169732-148169754 ATCCACTTCCTGTACCTGATGGG - Intergenic
914692332 1:150041942-150041964 TGCCACTTTCTGTACACTATAGG + Intergenic
917766871 1:178229710-178229732 AACCACTTTCTGTGTATTATTGG - Intronic
918690402 1:187472139-187472161 ATCCATTTTATGTATTTCATGGG - Intergenic
920391512 1:205606167-205606189 AAGCACTTTCTGTGTTTTATAGG - Intronic
921506869 1:215982563-215982585 TTGCACTTTCTGGACTTCATTGG - Intronic
1065227633 10:23561105-23561127 ATCCAGTTTCTCAACTTTATTGG + Intergenic
1067299458 10:44995563-44995585 ATCTAATTTCTGAACGTTATGGG + Exonic
1068334094 10:55608422-55608444 ACACATTTTCTGTACTTCATTGG + Intronic
1069139005 10:64800606-64800628 TCCTACTTTCTGTATTTTATAGG - Intergenic
1069293963 10:66820284-66820306 ATCCACTTTCTGTACTTTATAGG - Intronic
1071241414 10:83709506-83709528 ATCCTCTTGCTGTACTGTCTTGG + Intergenic
1071434210 10:85631925-85631947 GTCCTCTTCCTGTGCTTTATGGG - Intronic
1072888322 10:99299519-99299541 ATCCACTTGTTGTACTGTACAGG + Intergenic
1073223561 10:101896764-101896786 CTCCAGCTTCTGTAATTTATAGG - Intronic
1073886558 10:108046560-108046582 ATCCACTTTTTGTCCTATTTAGG - Intergenic
1074385668 10:113014827-113014849 TTCCTCCTTCTGTCCTTTATGGG + Intronic
1074408728 10:113204295-113204317 AGCCACTCTATGTATTTTATTGG - Intergenic
1075173507 10:120137849-120137871 ATTCACTATCTGGCCTTTATGGG - Intergenic
1077933044 11:6753559-6753581 ATCCACTTCTTGTACTGTAGAGG - Intergenic
1078253194 11:9635402-9635424 ATCCAACTTTTGTATTTTATTGG - Intergenic
1078360093 11:10661265-10661287 GTCCTCCTTCTATACTTTATGGG + Intronic
1080441143 11:32295817-32295839 CTCCAGTTTCTGTACTTTGCTGG + Intergenic
1081360643 11:42173123-42173145 ATCCAATTTCTTTACCTAATTGG - Intergenic
1086009836 11:82087931-82087953 AACCACTTTCTGTATATTCTAGG + Intergenic
1086675501 11:89602132-89602154 ATCCACTTTGAGTAGTTTTTAGG + Intergenic
1086840055 11:91673844-91673866 ATTCACATGCTGTACTTTTTAGG - Intergenic
1087659634 11:100971674-100971696 TTCCACTTTATTTACATTATGGG + Intronic
1088687004 11:112292498-112292520 TTGCCCTTTCTGTACTTTTTTGG + Intergenic
1090529656 11:127577358-127577380 ACCCACTTTCTGAACTTATTGGG - Intergenic
1092607804 12:10138953-10138975 ATTCACTTTTGTTACTTTATTGG + Intergenic
1092931186 12:13317330-13317352 CTCCAATTTCTGTGCTTTGTGGG - Intergenic
1093147029 12:15578831-15578853 ATCCATTCTCTGTCCTTTACAGG + Exonic
1093189621 12:16059015-16059037 CTCCATTTTCTGTACTCTAGTGG + Intergenic
1093316202 12:17653564-17653586 TTCCATTTTCTTAACTTTATGGG - Intergenic
1094183008 12:27612304-27612326 ATGCTCCATCTGTACTTTATTGG + Intronic
1094211137 12:27893314-27893336 ATCCACTTTATGTTTTTTATTGG + Intergenic
1099087705 12:78265976-78265998 ATCCAAGTTCTGTAACTTATTGG + Intergenic
1099166803 12:79317092-79317114 ATTCACTTTCACTATTTTATGGG + Intronic
1099612140 12:84887844-84887866 ATCTACTTTCAGTTCTTTAAGGG - Intronic
1101126987 12:101646069-101646091 AACCAATTCATGTACTTTATAGG - Intronic
1108994298 13:56706921-56706943 ATTCACTTTCTGTTTTTTTTGGG + Intergenic
1109681053 13:65753211-65753233 ATCAACTTTCTGGAAATTATTGG - Intergenic
1110286298 13:73753555-73753577 AGCCACTTTCTGTGCTCTAGGGG - Intronic
1110738281 13:78963975-78963997 ATGCCTTTTCTGTATTTTATAGG - Intergenic
1112510987 13:100009217-100009239 TTCCACTTTGTGTCCTCTATTGG - Intergenic
1113095510 13:106659953-106659975 ATGCCCTTTTTGTACTTTATTGG + Intergenic
1114357983 14:21935515-21935537 ATCAACTTTTTGTCTTTTATGGG - Intergenic
1115045288 14:28984860-28984882 ATCCACTCTCTGTACATAAGTGG + Intergenic
1116436786 14:44903794-44903816 GTTCACTTTCTGGACTTAATAGG - Intronic
1116943386 14:50812526-50812548 TTCCACTTTCTGGAATCTATGGG - Intronic
1122676674 14:103420615-103420637 ATCAACTATATGTACATTATTGG + Intronic
1124145337 15:27119947-27119969 GTCACCTTGCTGTACTTTATTGG + Intronic
1124467632 15:29952542-29952564 ATCCACTTGCTGTAGTTTCCTGG - Intronic
1126336335 15:47589599-47589621 GTCCACCTTCTTTGCTTTATAGG + Intronic
1127178929 15:56393567-56393589 TTTCACTTTATTTACTTTATGGG + Intronic
1129080857 15:73039114-73039136 ATCCACTGTCTGTAGTTGACTGG - Intergenic
1131307013 15:91253844-91253866 ACCCACTTCCTCTACTTTGTGGG - Intronic
1132377299 15:101337981-101338003 TTCCACTTTCGGGACTCTATTGG - Intronic
1135947713 16:26879478-26879500 ACTCACTTTCTGTCATTTATTGG - Intergenic
1137388574 16:48062382-48062404 CCCCACTTTCTGAACTTTTTTGG + Intergenic
1142345365 16:89550521-89550543 AACCACTTTCTGTTCTTCCTTGG - Exonic
1146255357 17:31389089-31389111 AGCCACTTGCTGAACTTGATGGG - Intergenic
1146998751 17:37344770-37344792 CTCCACTTTCTGAACATTTTGGG - Intronic
1147545300 17:41396662-41396684 TTCCACTTTCTGTAATGAATAGG + Intronic
1150880601 17:69021851-69021873 ATCCACTTTTAGAACTTTACAGG - Exonic
1151261258 17:72917675-72917697 ATCCACTGGCTGCTCTTTATTGG + Intronic
1157098003 18:44704275-44704297 ATGCTCTTTGTGGACTTTATGGG + Intronic
1159040060 18:63316788-63316810 ATCCACTTGCAGTAATTTCTAGG + Intronic
1159510113 18:69387006-69387028 ATCCACTTTCTTTATTCTAGAGG - Intergenic
1159593008 18:70355153-70355175 TTCCACTTTCTGTCATTTAGTGG - Intergenic
1159820019 18:73129545-73129567 ATCCATTTTCAGTTCTTAATGGG - Intergenic
1167769007 19:51502089-51502111 ATCCACAGCCTGTACTTCATAGG - Intergenic
1167923241 19:52801730-52801752 ATACACCATCTGTACTTCATTGG - Intronic
925051450 2:818892-818914 ATCCAATCTCTGTACTATTTAGG - Intergenic
926266699 2:11329235-11329257 ATCCTCTTTATGTACTTTGGTGG + Intronic
926396993 2:12453832-12453854 ATCCACCTTCTCAACTTTTTAGG - Intergenic
928338062 2:30415662-30415684 GTCCAATTTCTCTACTTTCTTGG + Intergenic
928526418 2:32146258-32146280 GGCCATTTTCTGTACTTTAATGG - Intronic
928650827 2:33401822-33401844 AGACACTTGCTGTACTTTTTTGG - Intergenic
928773178 2:34726424-34726446 CTCAACTTTCTGTATTTCATTGG + Intergenic
930532165 2:52602791-52602813 ATCCAATTTCTGGAATATATGGG - Intergenic
932104028 2:68926778-68926800 ATCCAACTTCTGTCCTTTATGGG + Intergenic
936382784 2:112001998-112002020 GACCACTTTCTTTCCTTTATTGG + Intronic
937259100 2:120574095-120574117 ATCCACTTCCTGGGCTTTCTGGG + Intergenic
937405432 2:121623694-121623716 ATTCAATCTCTTTACTTTATTGG + Intronic
937406061 2:121630256-121630278 AACAACTTTCTGGAATTTATTGG - Intronic
939750085 2:146033210-146033232 TTACACTATCTGTTCTTTATTGG + Intergenic
940202614 2:151167959-151167981 ATGCACTTCATGTCCTTTATGGG - Intergenic
940218569 2:151326624-151326646 ATCAACATTCTGAACTTTTTTGG + Intergenic
940280663 2:151986374-151986396 AGCCTCTGTCTGTATTTTATGGG + Intronic
941547028 2:166864173-166864195 ATTCAAATTCTGTACTTTAATGG - Intergenic
943252508 2:185546609-185546631 ATCCTCTTTCTGAAGTTTTTGGG + Intergenic
943287318 2:186018733-186018755 ATCTAATTTCTGTACTGTAAAGG - Intergenic
944038428 2:195326124-195326146 ATCCACTTTCTGAAATTTGAAGG + Intergenic
945406706 2:209457652-209457674 ATCCACCATATGTACTTCATAGG + Intronic
947233589 2:227917214-227917236 ATCTACTTTTTCTTCTTTATTGG + Intronic
948093247 2:235313758-235313780 ATCCATTACCTGTACCTTATTGG - Intergenic
948298520 2:236884242-236884264 ATCTTCGTTATGTACTTTATAGG + Intergenic
1168863481 20:1063459-1063481 ATCCATGTGCTGTAGTTTATTGG + Intergenic
1169198375 20:3695282-3695304 CTCCCTTTTCAGTACTTTATGGG - Intronic
1170252960 20:14305912-14305934 ATTCACTCTCTCTCCTTTATTGG + Intronic
1170318382 20:15067107-15067129 ATGAACTTTCTCTACATTATCGG - Intronic
1170506443 20:17030484-17030506 ATACACTTTCTGTGTTTTAATGG + Intergenic
1173058981 20:39643953-39643975 ATCTAGGTTCTGTCCTTTATTGG - Intergenic
1174587037 20:51617443-51617465 CTCCACTTGCTGTAGTTTCTTGG - Intronic
1177740844 21:25151311-25151333 ATTCTATTTCTGTTCTTTATTGG - Intergenic
1177827006 21:26095332-26095354 ATTCACTTTCTGGACTGTGTGGG - Intronic
1178700580 21:34830255-34830277 AGCCACTCTGTTTACTTTATTGG - Intronic
1179134057 21:38664063-38664085 ATCCACAATCTGAATTTTATAGG - Intergenic
950340962 3:12243976-12243998 ATCCAATTCCTGAACTTTCTAGG + Intergenic
951053376 3:18119691-18119713 AAACTCTTACTGTACTTTATTGG + Intronic
951372883 3:21873504-21873526 ATCCACCTTCTTTCCTTTTTAGG + Intronic
951530585 3:23694605-23694627 ATCCTGCTTCTGTGCTTTATTGG + Intergenic
953196333 3:40737900-40737922 AGCCACTTTCTTTCCTTTAATGG + Intergenic
953971355 3:47350295-47350317 ATCCACTTTGTGTTCATTTTTGG + Intergenic
957376381 3:79364667-79364689 ATCCAGTTTCTGTATATTTTTGG + Intronic
958094128 3:88919531-88919553 AGCCTCTTTCTGTTATTTATAGG - Intergenic
961586073 3:127926248-127926270 ATCTACTTTCTAACCTTTATGGG + Intronic
962046719 3:131767901-131767923 ATCCAATTTCTGGACTGTCTGGG + Intronic
962429156 3:135303367-135303389 ATCTCCTTTCTGTCCTTTCTTGG - Intergenic
963364070 3:144311870-144311892 CTCCACATTCTGCAGTTTATAGG + Intergenic
964805324 3:160603334-160603356 ATCACCTTTCTGTATTTTATTGG - Intergenic
965084782 3:164080837-164080859 TTCCATTTTCTGTACATCATGGG - Intergenic
967034063 3:185634569-185634591 ATTAACTTTCTTTACCTTATCGG - Intergenic
967582105 3:191171392-191171414 ATACAATCTCTATACTTTATTGG + Intergenic
967734710 3:192939915-192939937 ATCCACTTCCTGAACTAAATTGG - Intergenic
972052857 4:34762182-34762204 ATACAATTTTTGTAATTTATTGG + Intergenic
975740833 4:77427430-77427452 AACCACTGTTTGTTCTTTATAGG - Intronic
976667680 4:87616636-87616658 CTCCCCTTTCTTTACTTTCTTGG - Exonic
977364476 4:96050049-96050071 ATCCACTTTGACTACTCTATTGG - Intergenic
978828968 4:113059590-113059612 GTACAGTCTCTGTACTTTATTGG - Intronic
978959913 4:114664336-114664358 ATCTTCTTTCTGTGCTATATAGG - Intronic
979094042 4:116521103-116521125 AGCCACTTTCTGTTCCTCATTGG - Intergenic
979587252 4:122435467-122435489 ATCCAAATTCTGTCCTTTCTAGG + Intergenic
979772806 4:124550374-124550396 TTAGACTTTCTGTTCTTTATAGG + Intergenic
979784143 4:124694083-124694105 TTCCACTTGCTTTACTTTATTGG - Intronic
980637221 4:135523099-135523121 TTCCCCTTTCTTTACTTCATTGG - Intergenic
980871869 4:138621358-138621380 ATCCATTTTATCTCCTTTATTGG - Intergenic
980918533 4:139058457-139058479 ATCCTCTTTCTGAAGTTTTTGGG + Exonic
984947173 4:184978918-184978940 ATACATTTTCTGTATTATATTGG + Intergenic
987284408 5:16441417-16441439 ATCCTTTTTCTCTTCTTTATGGG - Intergenic
987596931 5:20013347-20013369 ATACTCTTTCTGTACTTTTAAGG + Intronic
987685602 5:21196549-21196571 ATGCCCTTTTTGTACATTATTGG - Intergenic
989677306 5:43986697-43986719 ATACATTTTCTGTAGTGTATTGG + Intergenic
991599494 5:68338206-68338228 ATCCACTGTCGGTAGTTTGTGGG + Intergenic
992570541 5:78051930-78051952 ACCCACTTTCTACAGTTTATAGG - Intronic
992636029 5:78726780-78726802 ATCCATTTTCTGTTGTTTCTTGG + Intronic
992980305 5:82163600-82163622 ATCCACTTTCACTTATTTATTGG - Intronic
994199684 5:96958689-96958711 ATCCATTTCCTGCACTTTTTTGG + Intronic
994512547 5:100723678-100723700 ATCTACATACTGTATTTTATTGG - Intergenic
994743672 5:103652458-103652480 ATACACTTTCTGTTCTTTTTTGG + Intergenic
996133627 5:119811625-119811647 ATCCTCTCTCACTACTTTATAGG + Intergenic
996576005 5:124976889-124976911 ATCTAATTTCTGTATTTTTTGGG + Intergenic
998769508 5:145525916-145525938 ATCCATTTTCTTTTCTTTCTGGG + Intronic
998998387 5:147892515-147892537 ATCCTCTTTCTGTCACTTATTGG + Intronic
1000934406 5:167290927-167290949 ATCCATTTTCGTCACTTTATGGG + Intronic
1001068165 5:168556901-168556923 TTGCACTTTCTGTATTTTACAGG - Exonic
1002654197 5:180730167-180730189 ATAATCTGTCTGTACTTTATTGG - Intergenic
1004057669 6:12156910-12156932 ATCCACTCTCGGTAATTAATGGG - Intronic
1005391218 6:25335559-25335581 ATCCTATTTCTCTCCTTTATTGG - Intronic
1005665266 6:28046533-28046555 ATCTACTTTCTGAGCTTTCTGGG + Intergenic
1006476209 6:34256124-34256146 ATCCACTTTATTTTCTTTGTTGG - Intergenic
1009897207 6:69766970-69766992 ATCCACTTCATCTAATTTATTGG + Intronic
1009982937 6:70746943-70746965 AACAACTTCCTGTACTCTATAGG - Intronic
1010052064 6:71517353-71517375 ATCCATTTTCTGTAAGTTTTTGG + Intergenic
1013063286 6:106658579-106658601 TTCTTCTTTCTGTACTTTAAAGG + Intronic
1013421442 6:109970708-109970730 ATCCACTTGGAGTATTTTATGGG - Intergenic
1015450888 6:133364923-133364945 ATCCTCTTTTTGTCCTTTCTTGG + Intronic
1016334076 6:142984858-142984880 TTCTATTTTCTGTAGTTTATAGG + Intergenic
1017152749 6:151295689-151295711 ATCCACTTTCAATACCTGATTGG - Intronic
1019965464 7:4495202-4495224 ATCTACTTTATGTTTTTTATAGG - Intergenic
1020481401 7:8666566-8666588 TTCCAATTTCTTTAATTTATTGG + Intronic
1020786167 7:12575417-12575439 ACCCATTTTCTGGATTTTATGGG + Intronic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1023140143 7:37094000-37094022 TTCCACTTTCTGAAGTGTATAGG + Intronic
1023965222 7:44960625-44960647 GTCCAGTCTCTGTACTTTCTGGG - Intergenic
1024396641 7:48876434-48876456 ATCCACTGTCTTTACTGTTTGGG + Intergenic
1027885824 7:83903787-83903809 AAGCCCTTGCTGTACTTTATGGG + Intergenic
1028094036 7:86738237-86738259 CTCCATTTTCTGTTCTTTCTGGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1033274480 7:139960908-139960930 TTCCATTTTCTGAAGTTTATGGG - Intronic
1039024451 8:33242464-33242486 ATCCACTTGGTGTCCTTTGTGGG + Intergenic
1043526094 8:81097952-81097974 ATCCAATTTCTGCAAATTATAGG - Intronic
1044369900 8:91397879-91397901 ATGCACATTCTGTATTTTGTGGG + Intronic
1045241793 8:100408980-100409002 ATCCTCTTTCTCTACCTTCTAGG - Intronic
1045913650 8:107440380-107440402 ATCCAATTTCTTTAGTTTATAGG + Intronic
1046301175 8:112292996-112293018 ATCCTTTCTCTCTACTTTATTGG + Intronic
1046798657 8:118399711-118399733 ATCTACTTTCAGAAGTTTATTGG - Intronic
1047694161 8:127386202-127386224 CTCCACATTCTGTGTTTTATAGG - Intergenic
1048525503 8:135198682-135198704 GTCTATTTTCTGTACTATATCGG - Intergenic
1048593105 8:135839791-135839813 ATCCACTTTCTGAGCTCCATAGG + Intergenic
1048903202 8:139060218-139060240 CTTGACTTTCTGTACTATATGGG + Intergenic
1050361785 9:4837407-4837429 ATACACTTTCAGTACTATTTTGG + Intronic
1051561095 9:18441121-18441143 ATCTACTTTTTGTATCTTATGGG - Intergenic
1052060305 9:23952630-23952652 AACATTTTTCTGTACTTTATTGG - Intergenic
1052201284 9:25784263-25784285 CTCCACTTTCTGCATTTTCTTGG + Intergenic
1052545475 9:29872256-29872278 CGCCACTTTATGTCCTTTATTGG + Intergenic
1055709938 9:79049811-79049833 AGTCACTTTCTGTAGATTATTGG - Intergenic
1058473897 9:105310610-105310632 ATCCAGTTAATGCACTTTATAGG + Intronic
1060758775 9:126231573-126231595 ATCAACCTTCTGTACTGTCTGGG + Intergenic
1061528482 9:131189564-131189586 TTTCACTTTCTCTACCTTATAGG - Intronic
1062064814 9:134520879-134520901 GTCCACTGTCTGTCATTTATAGG + Intergenic
1187382091 X:18812013-18812035 ATCCAATTTATGTGCTTTTTTGG + Intronic
1188364079 X:29292947-29292969 AGGCACTTTCTGTAGTTTTTTGG + Intronic
1190019462 X:46860595-46860617 ATCCAGTATCTGAAATTTATTGG - Intronic
1190394300 X:49964597-49964619 ATCCACTTAATTAACTTTATGGG - Intronic
1191582891 X:62784937-62784959 ATCTTCTTTCTATATTTTATTGG + Intergenic
1191930852 X:66370649-66370671 ATTCAATTTCTGTACTTGTTAGG + Intergenic
1191931721 X:66380581-66380603 CTCCACTTGCTGTATGTTATTGG + Intergenic
1192753020 X:74014736-74014758 AGCCACTCTCTGTTCTTTTTAGG - Intergenic
1194497955 X:94640319-94640341 ATCAAATTTCTGTTCTTTATTGG + Intergenic
1195038665 X:100993520-100993542 ATCCACTTTCTCTTCTCTATTGG - Intergenic
1195693281 X:107646934-107646956 ATCCACTTCCTCTTCTTTCTGGG - Intronic
1195945011 X:110200204-110200226 TTCCTCTTTCCCTACTTTATGGG + Intronic
1196740955 X:119025438-119025460 ATACACTGTCTGTCCTTTCTGGG - Intergenic
1197195346 X:123694314-123694336 AGCCCCTTTCTGTTCTTTCTAGG - Intronic
1199226322 X:145378923-145378945 CTCAACTTTCTCTAGTTTATAGG - Intergenic
1200429722 Y:3064912-3064934 ATTCATTTTCTGTAATTTAAGGG + Intergenic