ID: 1069296415

View in Genome Browser
Species Human (GRCh38)
Location 10:66850660-66850682
Sequence CTACCCAGCTTGAAAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 304}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069296415 Original CRISPR CTACCCAGCTTGAAAAAAAA TGG (reversed) Intronic
900871050 1:5303531-5303553 TTACCCAGCCTTAAAAAAGAAGG + Intergenic
901706981 1:11081404-11081426 CTACCCAGCTGTTAAAATAATGG - Intronic
902902209 1:19525653-19525675 CATGCCAGCTTGAAAAAAGATGG - Intergenic
903489561 1:23717969-23717991 TTACTCAGCCTTAAAAAAAAAGG + Intergenic
904259184 1:29278671-29278693 CTACCCAACTGGAACAAAATTGG + Intronic
907295412 1:53448975-53448997 TCACACAGCTAGAAAAAAAATGG - Intergenic
908171947 1:61513558-61513580 CTCTCCAGCTTCAAAAAAGAAGG - Intergenic
908479923 1:64529191-64529213 GTACCCTGTTTGAAAAAAGATGG + Intronic
909349940 1:74639893-74639915 GTATCCAGATGGAAAAAAAAGGG + Intronic
909906861 1:81207527-81207549 CTATTCAGCTTTAAAAAAGAAGG + Intergenic
910009232 1:82440043-82440065 CTATCCATCTGGACAAAAAAGGG + Intergenic
910640200 1:89452531-89452553 TTACCCAGTTTTTAAAAAAATGG - Intergenic
910662868 1:89692458-89692480 CTACTCAGCTTGGAAAATACTGG + Intronic
910726234 1:90342336-90342358 TTACACAGCAAGAAAAAAAAAGG + Intergenic
911723590 1:101218220-101218242 CCTCCCAGTTTGAAAAAAATTGG - Intergenic
912185475 1:107270043-107270065 AAGCCCAGCTTGAAATAAAATGG - Intronic
913404145 1:118470153-118470175 CAAGCCAGCTTGACAAAAAAGGG + Intergenic
916363994 1:164003288-164003310 CTACACAGCTATAAAAAGAATGG + Intergenic
916731754 1:167572919-167572941 CTCTCCAGGTAGAAAAAAAAGGG - Intergenic
917005054 1:170405866-170405888 CTCCCCATTTTAAAAAAAAATGG + Intergenic
917586229 1:176429814-176429836 CTAATCATCTTCAAAAAAAATGG + Intergenic
917818291 1:178733384-178733406 CAACCCAGTTTTAAAACAAATGG + Intronic
919109554 1:193200645-193200667 CTACCCAGCGGGGAAAAGAAAGG - Intronic
919595396 1:199555704-199555726 CTACCAAGATTGAAAAATGAAGG + Intergenic
920544641 1:206805868-206805890 CAAACCAGCTTAAACAAAAAAGG + Intronic
920614720 1:207478876-207478898 CTACTTAGAGTGAAAAAAAAAGG + Intronic
920630014 1:207643234-207643256 CTTCCAAGCCTGAAAATAAATGG + Intergenic
923011278 1:230089744-230089766 TTACCCAGCTTTAAAAAGAAAGG - Intronic
923646006 1:235820878-235820900 CTATACAGCTAGAAAAGAAAAGG - Intronic
1063357930 10:5419233-5419255 ATAAACAGCTTGAAAATAAAGGG - Intronic
1064514958 10:16137162-16137184 CTACTCAGCTTTAAAAAAGATGG + Intergenic
1066053122 10:31655166-31655188 CTAACCTGATTTAAAAAAAAAGG + Intergenic
1066575756 10:36822758-36822780 ATAATCTGCTTGAAAAAAAAAGG - Intergenic
1067718917 10:48711812-48711834 CTTTCCATTTTGAAAAAAAATGG - Intronic
1069296415 10:66850660-66850682 CTACCCAGCTTGAAAAAAAATGG - Intronic
1070350363 10:75586009-75586031 CTACCCACCCTTAAAAAAAAGGG - Intronic
1070476467 10:76834155-76834177 TTTCCCTGCTTGAAAAAAATGGG - Intergenic
1071326571 10:84524362-84524384 CTAACCTACTTGAAAAAAAATGG - Intergenic
1072006797 10:91258691-91258713 CTAGACAGCATGAAAACAAAGGG - Intronic
1072824652 10:98594635-98594657 CTACTCAGCCTTAAAAAGAAGGG - Intronic
1077256507 11:1586069-1586091 CTACTCAACTTGGGAAAAAATGG + Intergenic
1077261536 11:1624061-1624083 CTACCTATGTTGAAACAAAATGG - Intergenic
1078360623 11:10664979-10665001 CAAGCCAGCTTAAGAAAAAAGGG - Intronic
1078490806 11:11766619-11766641 CTACTCAGCCTTAAAAAAGAAGG + Intergenic
1078865276 11:15291503-15291525 CTACCAAGGTTGAAATAGAAGGG + Intergenic
1079700125 11:23535528-23535550 CTACCCAGCCATAAAAATAATGG - Intergenic
1080319348 11:30988405-30988427 CTATTCAGCTTGAAAAAAAATGG + Intronic
1080992640 11:37557916-37557938 TTTCACAGCTTGAAAAAAAGGGG - Intergenic
1081039050 11:38187397-38187419 CGACCCAGTTTGCAAAAATAAGG + Intergenic
1083519778 11:63297851-63297873 CTGTGCAGCTTGAGAAAAAATGG + Intronic
1085000669 11:73031018-73031040 CTATTCAGCCTTAAAAAAAAGGG + Intronic
1085747762 11:79129439-79129461 CTTCCCAGCTGCAAAAGAAAAGG - Intronic
1086975569 11:93128823-93128845 CTACCCAGCTTGGAAACCATAGG + Intergenic
1086981386 11:93201841-93201863 TTCCCCAGATTAAAAAAAAATGG + Intergenic
1087624961 11:100585621-100585643 CTACCCCCCATGCAAAAAAAAGG - Intergenic
1088139583 11:106599548-106599570 CAACCCAGCTTGAAAAAGAGGGG + Intergenic
1089194048 11:116681553-116681575 TAACACAGGTTGAAAAAAAATGG + Intergenic
1089714140 11:120340016-120340038 CCAAACAGCTTTAAAAAAAATGG + Intronic
1090343460 11:126046729-126046751 CTGGCCAGCTAGAAACAAAACGG + Intronic
1090436552 11:126691828-126691850 ATAACCAGATTTAAAAAAAATGG + Intronic
1090556478 11:127882191-127882213 AAACTCAGCATGAAAAAAAATGG + Intergenic
1090916571 11:131169530-131169552 CAACACAGCTTGCAAATAAATGG + Intergenic
1091002616 11:131923051-131923073 GTACCCCGTTTAAAAAAAAAAGG + Intronic
1091527673 12:1320437-1320459 CTACTCTGCTGGAAAGAAAAGGG - Intronic
1091747542 12:3002199-3002221 TTACCCAGCCTTAAAAAAGAGGG - Intronic
1092787598 12:12041957-12041979 ATATTCAGATTGAAAAAAAAAGG + Intergenic
1093172278 12:15874414-15874436 CTTCCCAGCTGCAAAATAAAAGG - Intronic
1093231680 12:16552517-16552539 CTACCCAGTTGGAAAAAAATAGG - Intronic
1093292097 12:17339407-17339429 TTATCCAGCTTTAAAAATAATGG - Intergenic
1093919966 12:24848868-24848890 CTACCCAAATTAAAAAAGAACGG - Intronic
1094290677 12:28845598-28845620 CTACTGAGCTTGAAGAAATATGG - Intergenic
1094501842 12:31028535-31028557 CTATGCAGCTTTAAAAAGAATGG + Intergenic
1096206551 12:49727248-49727270 CAACCCAAGTTAAAAAAAAATGG + Intronic
1096922808 12:55107071-55107093 GTTCCTACCTTGAAAAAAAAAGG + Intergenic
1097760492 12:63459243-63459265 CCACCCAGCTGCAAAAGAAAAGG - Intergenic
1097898202 12:64847095-64847117 CTACCAAGATTGAAAAATGAAGG - Intronic
1098546052 12:71712111-71712133 ATACCCCACTTAAAAAAAAATGG + Intergenic
1099157151 12:79192391-79192413 CTACCCATCCTGAAGACAAAAGG - Intronic
1099364778 12:81754803-81754825 CTAGTCAGTTTGAAAAAAATCGG - Intronic
1100021267 12:90072080-90072102 CTACCCAGAATGAAGTAAAATGG - Intergenic
1100721587 12:97364904-97364926 ATAGCCAACTTGAAAAAACAAGG - Intergenic
1100747085 12:97658099-97658121 CAACACAGCTTAAGAAAAAAAGG + Intergenic
1105392687 13:19995684-19995706 CTATCAACCTTCAAAAAAAAAGG - Intronic
1105402358 13:20106654-20106676 TTGCCCAGGTTGAAAGAAAAAGG - Intergenic
1105703130 13:22948653-22948675 CTTCCCACCCTGAAAGAAAAAGG + Intergenic
1107101887 13:36601896-36601918 CCACTCAGCTAGAAAAACAAAGG + Intergenic
1107610896 13:42111907-42111929 CAACCCAGGTATAAAAAAAATGG - Intronic
1107960544 13:45554298-45554320 CTACTCAGCCTTAAAAAAGAGGG - Intronic
1110295262 13:73856629-73856651 CTACTCAACTTTAAAAAATAAGG + Intronic
1111287874 13:86119185-86119207 CTTCTCAGCTTCAAAAAGAAGGG - Intergenic
1111412386 13:87894176-87894198 TCACCCACTTTGAAAAAAAAAGG - Intergenic
1111473413 13:88716937-88716959 TTACCAAGCTTCAGAAAAAAAGG + Intergenic
1112384276 13:98923519-98923541 TTACCCACCTTGAAAAGCAAGGG - Intronic
1113807785 13:113119972-113119994 CTTCCCAGCTTCACAATAAACGG + Exonic
1114188692 14:20424130-20424152 GACCCCATCTTGAAAAAAAAAGG - Intergenic
1114694824 14:24616839-24616861 CCACCCAGATTTAAAAGAAAGGG + Intergenic
1115863553 14:37716464-37716486 ATAGCCAGTTTGAAAATAAAAGG + Intronic
1119121239 14:72079867-72079889 CTACTCAGCCTTAAAAAAGAAGG - Intronic
1120057653 14:79944125-79944147 CTAATCAGCATGAAATAAAATGG + Intergenic
1121326189 14:93021106-93021128 CAACCAAGCTTGAGACAAAATGG + Intronic
1124557075 15:30736172-30736194 CTTCCCAGCTGGAAAGAAAGGGG - Intronic
1124674183 15:31669572-31669594 CTTCCCAGCTAGAAAGAAAAGGG + Intronic
1124782458 15:32649054-32649076 CTATGGAGCTTTAAAAAAAAAGG - Intronic
1125980841 15:43999756-43999778 CTACCCAGCCTGTAAAAAGGAGG - Intronic
1126464088 15:48944608-48944630 CTACCTAACATGAACAAAAAGGG + Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126845772 15:52759314-52759336 CTACCCAGCTGGAAATGAAAGGG - Intronic
1128009260 15:64276609-64276631 CCACCCAGGTAGGAAAAAAAAGG + Intronic
1131366038 15:91841340-91841362 CTACCTAACTTTAAGAAAAAGGG - Intergenic
1132126700 15:99232945-99232967 CTACTCAGCCTTAAAAAAGAAGG + Intronic
1132800309 16:1748831-1748853 CAACAAAGCTGGAAAAAAAAAGG - Intronic
1133544683 16:6794375-6794397 CTACACTCTTTGAAAAAAAATGG + Intronic
1136455193 16:30376322-30376344 CTACCCAGCTGAAAAATGAATGG + Intronic
1137293820 16:47071083-47071105 CTACCGAGCATTAAAAAAGAAGG + Intergenic
1137470498 16:48751683-48751705 CTACCAAGATTGAACCAAAAAGG + Intergenic
1137612437 16:49827795-49827817 CTACCCCCACTGAAAAAAAAAGG - Intronic
1139171962 16:64641381-64641403 TAACCCAGTTTAAAAAAAAATGG - Intergenic
1139316754 16:66078564-66078586 CTACTCAGCCTTAAAAAAGAAGG - Intergenic
1140295886 16:73709438-73709460 CTATCCAGCCTTAAAAAAGAAGG + Intergenic
1140566388 16:76047774-76047796 CTACACAGCTATAAAAAATAAGG - Intergenic
1141067672 16:80927246-80927268 CTACCCAGACTTAAAAAAATGGG + Intergenic
1142732966 17:1874583-1874605 CTACCCAGCATGAAATAGATTGG + Intronic
1142815509 17:2421948-2421970 CTTCCCAGCTTGAGATAGAATGG - Intronic
1142909001 17:3071327-3071349 TTACTCAGCTTGTAAAAGAATGG + Intergenic
1142925561 17:3232915-3232937 TTACTCAGCTTGTAAAAGAATGG - Intergenic
1143783891 17:9243046-9243068 CCACCCAGCTGGTAAGAAAAAGG - Exonic
1144329621 17:14212226-14212248 CTCCCCAGCTTCAACAAACACGG + Intergenic
1147663411 17:42129697-42129719 CTAGGCAGCTGGAAACAAAATGG - Intronic
1148993908 17:51690910-51690932 CTACTCAGCCTTAAAAAAAAAGG - Intronic
1150935810 17:69634167-69634189 CTATTCAGCTTTAAAAAAGAGGG + Intergenic
1153014572 18:571992-572014 CTACCGAGCTGGACTAAAAAGGG - Intergenic
1153791069 18:8580058-8580080 CCACCCAGTTTTTAAAAAAATGG - Intergenic
1155849678 18:30755855-30755877 CTATCAAGATTGAACAAAAAAGG + Intergenic
1162906606 19:13827635-13827657 CTTCCCAGCTAGAACAAACAAGG + Intronic
1164974605 19:32562869-32562891 CTACCCAGGTCCAGAAAAAAAGG + Intergenic
1165558142 19:36654187-36654209 CTACCCAGGTATAAAAAAACTGG + Intronic
1165705096 19:37970231-37970253 CCAGCCAGCCTGAAAAAATATGG - Intronic
1165967245 19:39592899-39592921 CTAGCAAGCTTGTAAAGAAAAGG + Intergenic
925957244 2:8978843-8978865 GCACCCATCTTAAAAAAAAAAGG + Intronic
926276731 2:11409214-11409236 CTGCTCAGCCTGAAAACAAAAGG - Intergenic
926457036 2:13079837-13079859 TTACCAAGGTGGAAAAAAAAAGG + Intergenic
927598524 2:24419457-24419479 CTACCCATATAGAAAAGAAATGG + Intergenic
929952077 2:46419767-46419789 CTATACAGCCTTAAAAAAAAAGG + Intergenic
930146339 2:48009383-48009405 CTAGCCACTTTTAAAAAAAATGG + Intergenic
931827402 2:66015909-66015931 AAAAACAGCTTGAAAAAAAATGG + Intergenic
931893038 2:66696204-66696226 CACCCCAGATTAAAAAAAAAAGG - Intergenic
932361051 2:71106111-71106133 CTACTCAGCCTTAAAAAAGAAGG + Intergenic
933129258 2:78652582-78652604 CTTCCCCGCTTCAAAAAAAATGG + Intergenic
933450805 2:82447897-82447919 ATACCTAGCTTGAAAGAAACAGG + Intergenic
936118325 2:109720404-109720426 CTAAGGAGCTTTAAAAAAAATGG + Intergenic
936373882 2:111924719-111924741 CTACTCTGCTAGAACAAAAATGG - Intronic
936663060 2:114563720-114563742 CAAACCAACTTTAAAAAAAATGG - Intronic
937998448 2:127713220-127713242 CTACCTAGATTGGAAATAAAGGG - Intronic
938213597 2:129489482-129489504 CTACTCAGCCTTAAAAAAGAAGG - Intergenic
938928432 2:136065271-136065293 CTACTCAGTCTGAAAAACAAAGG + Intergenic
938985962 2:136576583-136576605 ATACTTAGCATGAAAAAAAAAGG + Intergenic
939008114 2:136812855-136812877 CTACCCAGTCTGAAAAACAATGG - Intronic
939511933 2:143117708-143117730 CTACTCAGCCTTAAAAAATAAGG + Intronic
939631867 2:144535298-144535320 TTGCCCAGTTTGGAAAAAAAGGG + Intergenic
940388040 2:153096728-153096750 ATACACAGATTGAAAATAAAGGG - Intergenic
940660574 2:156540104-156540126 AGACCTAGCTTGAAAAATAAGGG + Intronic
941063200 2:160871365-160871387 CTACCCAGCTTCTCAAGAAAGGG + Intergenic
941380095 2:164782009-164782031 CTATCCAGTTAAAAAAAAAATGG + Intronic
942282631 2:174382010-174382032 CTACCCATCCTAACAAAAAAGGG + Intronic
943129109 2:183835670-183835692 CTACTCAGCCTTAAAAAAGAGGG - Intergenic
943630458 2:190245574-190245596 CTTCCCCACTTTAAAAAAAAAGG + Intronic
944391122 2:199220712-199220734 CTAAGCAGCTTCAAAAAGAAGGG - Intergenic
944626738 2:201577547-201577569 CTATGCAGCTTTAAAATAAAAGG + Intronic
944773929 2:202942680-202942702 ATACACATCTTTAAAAAAAATGG + Intronic
945227706 2:207549419-207549441 CTCCCCCGCTTAAAAAAAAAAGG + Intronic
945595393 2:211784432-211784454 TTATCCAGCTTGAAAAAGGAAGG - Intronic
947127353 2:226883559-226883581 CTACCCAGGTTGAAACTAATTGG + Intronic
948240193 2:236424994-236425016 CTATTCAGCTTTAAAAAAGAAGG - Intronic
1170322249 20:15112920-15112942 TTATCCAGCCTGGAAAAAAAAGG - Intronic
1170382663 20:15778266-15778288 CTACCAACCTGGGAAAAAAATGG - Intronic
1172111605 20:32548879-32548901 CTACACAGCTGTAAAAAAGAAGG + Intronic
1175030402 20:55947778-55947800 ATATCCAGGTTGAAAAAGAAAGG + Intergenic
1177461526 21:21417747-21417769 CTACCTAGAGTGAAAAAGAATGG + Intronic
1182308270 22:29386643-29386665 TCACACAGCTTAAAAAAAAAAGG + Intronic
1182818129 22:33187299-33187321 CTATCCAGCTTTTAAAAAGAAGG + Intronic
1184024649 22:41846204-41846226 CTATCTAGCTTGAACAGAAAAGG + Intronic
949753226 3:7378356-7378378 CTACCAAGCCTGAAAATAATTGG + Intronic
950378475 3:12591364-12591386 CAACTCAGCTATAAAAAAAAGGG + Intronic
950688329 3:14635315-14635337 CCAACCAGCTTGAGCAAAAAGGG + Intergenic
952220281 3:31317412-31317434 CTACCCAGATTCAAAAGGAAGGG + Intergenic
955091560 3:55756669-55756691 CAAATCAGCTTGAAAACAAAGGG + Intronic
956981405 3:74643100-74643122 CTACCCACTATGAAAAAATAGGG + Intergenic
958969993 3:100600894-100600916 CCTCCCAGCTTGGAAAGAAAAGG + Intergenic
958998934 3:100939422-100939444 TCAGCCAGCTTGAAAAATAAAGG + Intronic
960726020 3:120670941-120670963 CTACGCAGCTTGAGAGAATATGG + Intronic
961031355 3:123607038-123607060 CTACCCACCTCCCAAAAAAAAGG - Intergenic
961202321 3:125055290-125055312 CCACCCCACTTTAAAAAAAATGG - Intronic
961211609 3:125129982-125130004 CTCCCCAGCTGGTAAAATAAAGG + Intronic
962307398 3:134300837-134300859 ATACCCAGCTGGAAAAGAAGTGG - Intergenic
963223245 3:142833761-142833783 CCACCCAGTAGGAAAAAAAAGGG - Intronic
963348460 3:144124522-144124544 CTACCCTTCTGGAAATAAAAAGG - Intergenic
964361324 3:155899902-155899924 CTACCCAGACTGAAAAGACATGG - Intronic
965166748 3:165203792-165203814 CTACTTAGCAGGAAAAAAAATGG - Intergenic
965283915 3:166791682-166791704 CTATTCAGCTTAAAAAAAAAAGG - Intergenic
965290781 3:166876616-166876638 CTGTCCAGCTTTAAAAAAGAAGG + Intergenic
965946760 3:174251999-174252021 CTATCTACCTTGAGAAAAAAAGG - Intronic
967385373 3:188905796-188905818 CTACGCAGCTTAAAAATTAATGG - Intergenic
968197498 3:196720379-196720401 TTACTCAGCTTTAAAAAGAAGGG - Intronic
969835996 4:9842084-9842106 TTACACAGATTGAAAAAAAATGG - Intronic
970229579 4:13895176-13895198 CTACCCAATTTAAAAAAAAAGGG - Intergenic
971675505 4:29622237-29622259 CAACCCAGCCTAAAAGAAAAAGG + Intergenic
972082298 4:35168293-35168315 GTAACCAGCTGGAAAAAAACAGG - Intergenic
972114550 4:35613753-35613775 TTAACCTGCATGAAAAAAAATGG - Intergenic
974454073 4:62103571-62103593 CTCTACAGCATGAAAAAAAAGGG + Intergenic
974736684 4:65944549-65944571 TTACCCAGCTTTAAATATAATGG + Intergenic
975452992 4:74551730-74551752 CTTCCGAGCGTGAAAAAAGATGG - Intergenic
975987941 4:80221573-80221595 ACCCCCATCTTGAAAAAAAATGG - Intergenic
976357788 4:84139581-84139603 ATACCCAAATTGAAATAAAAGGG + Intergenic
977447349 4:97147820-97147842 CTAAGCAGTTTGAAAAAGAACGG - Intergenic
978740120 4:112127519-112127541 CTTCCCACTTTAAAAAAAAAAGG + Intergenic
978757323 4:112316799-112316821 AGACAAAGCTTGAAAAAAAATGG - Intronic
979106791 4:116699766-116699788 TTACCCAGTTAGAAAAAATATGG - Intergenic
980654968 4:135769942-135769964 TTACCCAGCATCAAAAACAAAGG + Intergenic
982682826 4:158452487-158452509 CTAAGCAGCTTGAAGAAAATAGG - Intronic
982716331 4:158812330-158812352 CTACCCGGCTGGAAAAAGGAGGG - Intronic
982908697 4:161112496-161112518 CTATGCAGCTTTAAAAAAGAAGG - Intergenic
982943766 4:161592077-161592099 CTACCAGGTTTGAAGAAAAAAGG + Intronic
983294954 4:165855220-165855242 TTAATCAGCTTGGAAAAAAATGG - Intergenic
984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG + Intergenic
986186010 5:5439028-5439050 TTTCCCATCTTGAAAAAAATGGG - Intronic
986462798 5:7990385-7990407 CTTCACAACTTGAAAAGAAAGGG + Intergenic
987023343 5:13897828-13897850 CTACCCAGATTCAAAAAAAGGGG - Intronic
987779564 5:22416630-22416652 CCTCCCAGCTAGAAAAAGAAAGG + Intronic
988422888 5:31027755-31027777 CTACCTAACAAGAAAAAAAAGGG + Intergenic
990302322 5:54461226-54461248 TCAGCCAGCTTGAAAAATAAAGG + Intergenic
992660146 5:78951341-78951363 CTAACAAGCTTGGAAGAAAAGGG + Intronic
993426444 5:87770833-87770855 CTACCCAGCATTAGAAACAAGGG - Intergenic
996560431 5:124822664-124822686 CTACTCAGCCTTAAAAAAAAAGG + Intergenic
999398914 5:151249516-151249538 CTGCCCAGCCTGGAAAAAATGGG - Intronic
1001760003 5:174199591-174199613 CTACGCAGCCTTAAAAAAGAAGG - Intronic
1004213986 6:13684402-13684424 CTACCCAGCCTGAACTAAAATGG + Intronic
1005030036 6:21499993-21500015 CATTCCAGCTAGAAAAAAAAGGG + Intergenic
1005145577 6:22686211-22686233 CTTCCCTGCCTGAAAAATAAAGG - Intergenic
1006702449 6:35986748-35986770 CTATTCAGCCTTAAAAAAAAAGG - Intronic
1009399515 6:63237777-63237799 CTTCCCAGCTTCCAGAAAAATGG - Intergenic
1009634188 6:66242914-66242936 CCACCAAGCTTTAAAATAAAGGG + Intergenic
1009809651 6:68644393-68644415 ATGCCCATCTAGAAAAAAAATGG + Intronic
1010751476 6:79620603-79620625 TTTCCCAGCCTGAAAAAAAGGGG + Intergenic
1010924629 6:81729312-81729334 ATACTCAGATTAAAAAAAAAGGG - Intronic
1012173317 6:96046811-96046833 CTTCCCAGATTGAATAAAAATGG - Intronic
1013264006 6:108476105-108476127 CCACCCCTCTTAAAAAAAAAAGG + Intronic
1013901328 6:115160512-115160534 ATACCCAGCTGGAGAAAACATGG + Intergenic
1016432263 6:143998737-143998759 GAACAGAGCTTGAAAAAAAATGG + Intronic
1017247926 6:152247255-152247277 CTACCCAACTTGGATTAAAAAGG - Intronic
1017621656 6:156305506-156305528 TTAGCCAGCTTAAAAAAAAAGGG - Intergenic
1020724652 7:11796333-11796355 CCATCCACTTTGAAAAAAAAAGG + Intronic
1024107259 7:46105177-46105199 TTGCCCAGTTTAAAAAAAAATGG - Intergenic
1029022831 7:97383474-97383496 CTCTCCAGCTATAAAAAAAAAGG - Intergenic
1029090523 7:98044555-98044577 GTCTCCAGCTCGAAAAAAAAAGG - Intergenic
1029651696 7:101897769-101897791 CTACCACACTGGAAAAAAAATGG - Intronic
1029795046 7:102885445-102885467 CAACCCAACTAAAAAAAAAAAGG - Intronic
1030323712 7:108197003-108197025 CTATCCAGCCTTAAAAAAGAAGG + Intronic
1031232718 7:119130204-119130226 CTATGCAGCTATAAAAAAAAAGG + Intergenic
1031275593 7:119717978-119718000 TTATTCAGCTTGAAAAAGAAAGG + Intergenic
1031589067 7:123567738-123567760 CTACCAGTCTTGAAAAATAAGGG - Intronic
1031960770 7:127987692-127987714 ATACCCAGTTTGAAAAACACTGG - Intronic
1032386694 7:131530220-131530242 CTGCCCAGCTGGCAATAAAAAGG - Intronic
1032392997 7:131568585-131568607 CCACCCAACTTGAATAAGAACGG + Intergenic
1032518939 7:132528098-132528120 CTAAACAGCTTGAATAAAGAAGG + Intronic
1032770345 7:135047235-135047257 CTATTCAGCTTTAAAAAAGAAGG - Intronic
1034057088 7:148046654-148046676 CTACCCAGCTCAAGAACAAAGGG + Intronic
1035067556 7:156119057-156119079 GTACCCTACTTGAAATAAAAGGG + Intergenic
1035852339 8:2933051-2933073 CCACACAGCCTGAAAAAAATAGG + Intergenic
1036289433 8:7474303-7474325 CTGCTCAGCTTGTAAAAGAAGGG + Intronic
1036332044 8:7837229-7837251 CTGCTCAGCTTGTAAAAGAAGGG - Intronic
1036492180 8:9237933-9237955 CCAGCCAGCAGGAAAAAAAAGGG + Intergenic
1040062747 8:43118218-43118240 TTACTCAGCTTTAAAAAGAATGG + Intronic
1040435048 8:47381921-47381943 CTACCCAGCTGGTAGAACAAAGG - Intronic
1040486039 8:47872563-47872585 CCACACAGATTGAAAATAAAGGG + Intronic
1041180862 8:55246603-55246625 CATCCCAGATTGAAAAACAAAGG - Intronic
1041930019 8:63276537-63276559 CCACCCAGATTAAAAAAAAATGG + Intergenic
1042039834 8:64579592-64579614 CACCCCACCTTAAAAAAAAATGG + Intergenic
1042737667 8:72006704-72006726 CTACTCAGCCATAAAAAAAACGG + Intronic
1043448336 8:80341008-80341030 TTACTCTGCATGAAAAAAAATGG - Intergenic
1043569455 8:81586174-81586196 CTACACAGCTATAAAAAGAATGG - Intergenic
1044372225 8:91425558-91425580 CTATTCAGCTTTAAAAAAGAAGG + Intergenic
1044584103 8:93853195-93853217 ATATCCAGCCTGAAAAAAGAAGG + Intergenic
1045316459 8:101047847-101047869 ATACTCAGTTTCAAAAAAAAAGG - Intergenic
1046161184 8:110367183-110367205 CTATTCAGCTTTAAAAAAGAAGG + Intergenic
1047531227 8:125678409-125678431 AAACCAAGATTGAAAAAAAAAGG + Intergenic
1047727873 8:127700099-127700121 TTACCCAACTTGAAAATCAATGG - Intergenic
1048070362 8:131014524-131014546 TTATCCTGCTTTAAAAAAAATGG - Intronic
1048567751 8:135621116-135621138 CTATGCAGCCTTAAAAAAAAGGG + Intronic
1050746450 9:8881951-8881973 CCACCCAGCAGGAAAAAACATGG - Intronic
1051493701 9:17695687-17695709 CTACCCTGACTGAAAAAAAGAGG - Intronic
1051983626 9:23055725-23055747 CTATCCAGCTTTAAAAAAGAAGG + Intergenic
1051983692 9:23056845-23056867 CTATCCAGCTTTAAAAAAGAAGG - Intergenic
1052838368 9:33269041-33269063 CTATCCAACTAGAAAAAGAATGG - Intronic
1054863623 9:69977788-69977810 CTTCCCAGGTTGGAGAAAAATGG + Intergenic
1055279767 9:74660976-74660998 CTACCCTGATTGAAAAACCACGG + Intronic
1055839059 9:80480843-80480865 TTACTCAGCATGAAAAAAGATGG - Intergenic
1056868328 9:90251639-90251661 CAACCCAACTGAAAAAAAAAAGG - Intergenic
1057341942 9:94210744-94210766 CTACCCAGCTTAAACAAAAGGGG - Intergenic
1057741049 9:97711428-97711450 CCACCCAGCCTGACAAAGAAAGG + Intergenic
1058325735 9:103695585-103695607 CTACCTAGATAGAAATAAAATGG + Intergenic
1059283728 9:113155495-113155517 CCTCCCAGCATGAAAAAAGAGGG + Intronic
1059798126 9:117722033-117722055 CTACCCAGGATGATAAAGAAGGG - Intergenic
1059924076 9:119188772-119188794 ATCCCCATCTTTAAAAAAAATGG + Intronic
1060122317 9:121004762-121004784 GACCCCATCTTGAAAAAAAAAGG + Intronic
1061104617 9:128519895-128519917 TTGGCCAGCTTGAAAAATAAAGG - Intronic
1185804043 X:3040605-3040627 CTCCTCAGCTTGGAAAAGAAAGG + Intergenic
1186035261 X:5415492-5415514 CTAGACAGCGTGAGAAAAAAGGG - Intergenic
1188160056 X:26788753-26788775 CAACTCAGCTTTAAAAAAGAAGG - Intergenic
1188209478 X:27404864-27404886 CTTTCCAGCTTGAACTAAAAAGG + Intergenic
1189378314 X:40483120-40483142 TTACCCAGTCTCAAAAAAAAAGG - Intergenic
1189932562 X:46029841-46029863 TTATCCAGCTTTAAAAAAGAAGG - Intergenic
1190471231 X:50781542-50781564 CTCCCCATCCTTAAAAAAAATGG - Intronic
1192389410 X:70710112-70710134 CTAATCAGCATCAAAAAAAAAGG + Intronic
1192990454 X:76448566-76448588 CTACACAGCCTTAAAAAAGAAGG - Intergenic
1193192932 X:78594331-78594353 CTACACAGCATGAAAATAAAGGG - Intergenic
1193473669 X:81937208-81937230 CTACTCAGATGTAAAAAAAATGG - Intergenic
1194204940 X:91001834-91001856 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1194460698 X:94164029-94164051 TTACTCAGCTTAAAAAAATAAGG - Intergenic
1194649959 X:96502718-96502740 CTACCCAACTTCAAAATACAAGG - Intergenic
1195874813 X:109528801-109528823 CTACCTATCTTTTAAAAAAACGG + Intergenic
1196013556 X:110913990-110914012 GAACACAGCTTGAAAAAATAGGG - Intergenic
1197011354 X:121568403-121568425 CAACTTAGCTTGAAGAAAAAGGG - Intergenic
1198123459 X:133619001-133619023 ATACCCAATTTAAAAAAAAATGG + Intronic
1198305299 X:135376253-135376275 CTATTCAGCATGAAAAAAACAGG + Intergenic
1198974056 X:142315331-142315353 CTACCCACATTCAAAAAGAATGG - Intergenic
1198982764 X:142418275-142418297 CTAACCAGCTGGTAAAACAAGGG + Intergenic
1199101503 X:143806308-143806330 ATACCCCGCTTTAAAACAAATGG + Intergenic
1199964146 X:152805501-152805523 ATAACCTGCTAGAAAAAAAATGG + Intergenic
1200345791 X:155447028-155447050 CTACCCAGTTTCAAAATACAAGG + Intergenic
1200550766 Y:4576977-4576999 TTACTCAGCTTGGAAAAGAAAGG + Intergenic
1202386584 Y:24332349-24332371 CCACACAGCTAAAAAAAAAATGG + Intergenic
1202484201 Y:25337779-25337801 CCACACAGCTAAAAAAAAAATGG - Intergenic