ID: 1069314211

View in Genome Browser
Species Human (GRCh38)
Location 10:67077468-67077490
Sequence AGGGTCCAGAATGGTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069314211_1069314221 21 Left 1069314211 10:67077468-67077490 CCAGTCCAACCATTCTGGACCCT No data
Right 1069314221 10:67077512-67077534 TCCTTTGCACAATGTTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069314211 Original CRISPR AGGGTCCAGAATGGTTGGAC TGG (reversed) Intronic