ID: 1069322677

View in Genome Browser
Species Human (GRCh38)
Location 10:67192212-67192234
Sequence AAAAGCAAAAAGATTTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069322675_1069322677 -6 Left 1069322675 10:67192195-67192217 CCAAAAGCACATGCAACAAAAGC 0: 6
1: 365
2: 3693
3: 18301
4: 12677
Right 1069322677 10:67192212-67192234 AAAAGCAAAAAGATTTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069322677 Original CRISPR AAAAGCAAAAAGATTTAAGT GGG Intronic
No off target data available for this crispr