ID: 1069323395

View in Genome Browser
Species Human (GRCh38)
Location 10:67201674-67201696
Sequence AAAGTAAAGCCTGATAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 370}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069323395_1069323397 14 Left 1069323395 10:67201674-67201696 CCTAAATTATCAGGCTTTACTTT 0: 1
1: 0
2: 0
3: 33
4: 370
Right 1069323397 10:67201711-67201733 CCTCCATTTCACATGTTTAAAGG No data
1069323395_1069323399 29 Left 1069323395 10:67201674-67201696 CCTAAATTATCAGGCTTTACTTT 0: 1
1: 0
2: 0
3: 33
4: 370
Right 1069323399 10:67201726-67201748 TTTAAAGGTGAGTTCTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069323395 Original CRISPR AAAGTAAAGCCTGATAATTT AGG (reversed) Intronic
900007391 1:70977-70999 AAAGTAAAGTTTGAAACTTTTGG - Intergenic
901133145 1:6975281-6975303 GGAGTAAACCCTGAAAATTTCGG + Intronic
901564142 1:10098298-10098320 AAAGAAAATCCTTATAATGTTGG + Intronic
906272077 1:44487463-44487485 AGAGTAAAGTCTCAAAATTTAGG + Intronic
906956323 1:50377854-50377876 AAAGTAGATCCTGAGAATTTGGG - Intergenic
907536411 1:55164197-55164219 CAGGTATAGCTTGATAATTTAGG + Intronic
908026867 1:59961120-59961142 AAAATAAAACATGATAAATTGGG + Intergenic
909006294 1:70280174-70280196 AAAGTAAATACTTATAATTGAGG + Intronic
909215970 1:72889608-72889630 ATAGTAAAGCTTGAAAATTATGG + Intergenic
909303493 1:74043183-74043205 AAAGTTATGCTTGTTAATTTAGG + Intronic
910025739 1:82648706-82648728 AAACAAAAGCCTCATATTTTGGG + Intergenic
910637566 1:89425879-89425901 AAAATCAAGCCTGGTAATTTAGG + Intergenic
910982616 1:92974058-92974080 AAACTAAAGCCAGAGAAATTAGG - Intergenic
910993621 1:93080170-93080192 CAAGAAAAGCCTCATATTTTTGG - Intronic
912852934 1:113142720-113142742 AATGGAAAGCCTGATATCTTCGG - Intergenic
912882730 1:113433483-113433505 AAAGTAAATCCTGAAGTTTTAGG - Intronic
913484278 1:119319627-119319649 AAAATAAAGCCTGAACTTTTTGG + Intergenic
915838922 1:159200068-159200090 GCAGTAAAGCCTGATCACTTGGG + Intronic
915845687 1:159262244-159262266 AAAAGAAAGCCTAATAGTTTAGG + Intergenic
916229534 1:162526636-162526658 AAGGTAAACCCAGAAAATTTTGG - Exonic
916275655 1:162990673-162990695 AAAGAAAAGCCTAATACTTTGGG - Intergenic
916624512 1:166540718-166540740 AAAGGAAAGCCTTCTGATTTTGG - Intergenic
916994142 1:170277585-170277607 AAAATAAAGCATGATAGTTATGG + Intergenic
917032707 1:170711923-170711945 AAAGAAATGTCTGATTATTTTGG - Intronic
917292272 1:173483021-173483043 AGAATAAAGCCAAATAATTTAGG + Intronic
917658269 1:177150377-177150399 AAGGTAAAGCATGTAAATTTGGG + Intronic
919162962 1:193854800-193854822 AATATTAATCCTGATAATTTAGG - Intergenic
919193340 1:194251922-194251944 CAAGTAAAGTTTAATAATTTTGG - Intergenic
919680349 1:200428268-200428290 AAAAGAAAGCATGAGAATTTTGG + Intergenic
919948859 1:202343803-202343825 TAAGTAAATCCCTATAATTTTGG + Intergenic
919958618 1:202443022-202443044 ATACTGAAGCCTGTTAATTTAGG + Intronic
920009946 1:202860354-202860376 AAAAAAAAGCCTGAGAACTTGGG - Intergenic
921028363 1:211312231-211312253 TAAGAAAAGCATTATAATTTTGG - Intronic
921460380 1:215418941-215418963 AAAGCAAAGCCAGATTATTTAGG - Intergenic
922340006 1:224647624-224647646 AAAGTGAAGCCTGGAAACTTGGG + Intronic
924752601 1:246908945-246908967 AAAGTAAGGTTTTATAATTTTGG + Intronic
1065304985 10:24359972-24359994 AAAGTAATTTCTGATTATTTGGG - Intronic
1066021566 10:31308917-31308939 AAAGAAAAGACAGATAATTAAGG - Intergenic
1066339555 10:34517320-34517342 CAAGTAAAGCATCAAAATTTAGG - Intronic
1067193606 10:44093589-44093611 AATGTATATTCTGATAATTTGGG - Intergenic
1067762388 10:49057992-49058014 ACAGTAAAGCCTGTTCATTTTGG + Intronic
1067870430 10:49955341-49955363 AAATGAAATCCAGATAATTTAGG + Intronic
1068424841 10:56846617-56846639 AAAGCAAAGCATTATAATCTGGG - Intergenic
1068492574 10:57742408-57742430 AAAGAAAAGCTTGATTAATTAGG - Intergenic
1068653336 10:59547951-59547973 AAAATAAAGAATGATAGTTTGGG + Intergenic
1069206612 10:65696918-65696940 AAACGAAAACCTGATATTTTTGG + Intergenic
1069323395 10:67201674-67201696 AAAGTAAAGCCTGATAATTTAGG - Intronic
1069553399 10:69380595-69380617 AAAGTAAAGTCTGAGGGTTTGGG - Intronic
1071020388 10:81047474-81047496 AAAGGAAAGCCTGATTCTCTTGG - Intergenic
1071029816 10:81163876-81163898 AGAGTAAAGTCTGAGTATTTTGG + Intergenic
1071372159 10:84963211-84963233 AAAGAAAAGCCAGAAAGTTTCGG - Intergenic
1071868076 10:89760241-89760263 AAAGTAAAGCAAGAGAATGTGGG + Intronic
1072014843 10:91336662-91336684 AAAAAAAAACCTGAGAATTTTGG + Intergenic
1072130440 10:92488906-92488928 AATGAAAAGCCTTATAAATTAGG - Intronic
1073921490 10:108465358-108465380 AAAGTGAACGTTGATAATTTGGG - Intergenic
1075130964 10:119739371-119739393 ATAGCAAAGACTGATATTTTGGG + Intronic
1076320111 10:129572720-129572742 ACAGTAAATTATGATAATTTGGG + Intronic
1077744509 11:4886424-4886446 AAAGTAAATACTGTTAATTCCGG + Intronic
1078292304 11:10024949-10024971 ATAGTCAAGACTGAGAATTTGGG - Intronic
1078794833 11:14582126-14582148 AACTGAAAGCCTTATAATTTTGG + Intronic
1079409195 11:20171265-20171287 AAAAGAAAGCCTGAGAAATTTGG + Intergenic
1079607200 11:22384828-22384850 AGATTAAAGCCAGAAAATTTTGG - Intergenic
1080576183 11:33601203-33601225 AAAGTAAACCCAGTGAATTTGGG + Intronic
1081334832 11:41852269-41852291 AAAATAAAACCAGATTATTTTGG + Intergenic
1083013633 11:59428056-59428078 AAAGAAAAGGCTGATAAGATAGG + Intergenic
1084925449 11:72507814-72507836 AAACTAAAGAGTGATGATTTAGG - Intergenic
1085346299 11:75769996-75770018 AAAATAAAGCTTGCTAATTATGG + Intronic
1085857659 11:80193853-80193875 AAAGGAAAGCCTGAGAAATGTGG - Intergenic
1086345140 11:85888620-85888642 AAATCAAAGACTGATAAGTTGGG - Intronic
1086770529 11:90759198-90759220 AAAGCAAAGGCTTTTAATTTTGG - Intergenic
1086992918 11:93325622-93325644 AAAGAGAAGCTTGAAAATTTTGG + Intergenic
1089296713 11:117473532-117473554 AACGTAATGCCTGATAAATCAGG + Intronic
1090172153 11:124614586-124614608 GAAGTGGAGCCTGAGAATTTGGG - Intronic
1090571918 11:128056632-128056654 AAAGGTAAGTCTTATAATTTTGG - Intergenic
1091527633 12:1319745-1319767 AAATGAAAGCCTCAGAATTTTGG + Intronic
1092315585 12:7410007-7410029 AAAGGCAAGACTGAAAATTTTGG + Intronic
1093759174 12:22887400-22887422 AAAGTAAACCCTCATACTTATGG - Intergenic
1093934489 12:24986144-24986166 AAAGGTAAGTCTGTTAATTTTGG + Intergenic
1096000641 12:48127086-48127108 AAGGTAAGGCCTGAAAGTTTGGG - Intronic
1097480186 12:60114726-60114748 AATATATTGCCTGATAATTTAGG - Intergenic
1097872987 12:64617064-64617086 AAATGAAAGCCTGCTCATTTTGG + Intronic
1098189190 12:67929970-67929992 AAAATAGAGCCAGATAAATTAGG - Intergenic
1098281525 12:68867464-68867486 AAAGCTAAGCATGCTAATTTGGG + Intronic
1098360228 12:69647280-69647302 AGAGTAAAGCCTGCTACTTAAGG - Intronic
1098742462 12:74191038-74191060 ATTGTAATGCCTGATACTTTTGG + Intergenic
1099160502 12:79235482-79235504 AAAGAAAAACTTGATAAGTTAGG + Intronic
1099240614 12:80134350-80134372 AAAGGAAAGCCTCATCAGTTGGG - Intergenic
1099741362 12:86639152-86639174 AAGGTAAAGCAAAATAATTTTGG - Intronic
1100232645 12:92624529-92624551 AAAGTAAAACATAATGATTTAGG + Intergenic
1101481218 12:105099305-105099327 GAAGGAAAGACTGATAATTAGGG - Intergenic
1102620657 12:114191990-114192012 CAAATAAAGACTGATAATTCAGG + Intergenic
1105645033 13:22307939-22307961 AAAGTAGATTCTGATAATTTTGG + Intergenic
1106350096 13:28921825-28921847 AAAGTAAAGTCTCATGATTACGG + Intronic
1106402908 13:29446637-29446659 AAAGCACTGACTGATAATTTTGG + Intronic
1107846758 13:44522277-44522299 AAGGTAGGGCCTGATCATTTAGG + Intronic
1108075964 13:46680088-46680110 AAAGTAAAGCGGGATATTTAAGG + Intronic
1110350390 13:74500709-74500731 AAACTAAAGCTTCATACTTTTGG - Intergenic
1110549132 13:76792238-76792260 AAAAAAAAGACTGATATTTTGGG - Intergenic
1110790178 13:79579343-79579365 AAAGTATATTCTGTTAATTTTGG + Intergenic
1111433600 13:88177812-88177834 AAAGTAAATACTGAAAATTGTGG - Intergenic
1111815049 13:93141936-93141958 AAGGAAAAAACTGATAATTTTGG - Intergenic
1112295104 13:98179544-98179566 AAGGGAAGGCCTTATAATTTGGG + Intronic
1112346637 13:98595650-98595672 AAAGTAAAGTCTCAGAAATTGGG - Intergenic
1113589790 13:111490399-111490421 AAAGTAAAGTCTGAGCATTTGGG + Intergenic
1114850603 14:26378609-26378631 ACAGGAAAGCCTGAAAATTGGGG + Intergenic
1114926026 14:27400114-27400136 AAAGTAAACTCTGATCATTTTGG - Intergenic
1116588704 14:46743510-46743532 ATAGTGAAGCCTGAGAATTTGGG - Intergenic
1116651299 14:47596063-47596085 AAAGGAAAGCTAGATAATTTGGG + Intronic
1116757013 14:48960820-48960842 AAAATATAGACTGATACTTTAGG - Intergenic
1116890146 14:50260029-50260051 AAAGTAGAGCCAGACATTTTTGG - Intronic
1117987766 14:61405337-61405359 AAAATAAAGTCAGAAAATTTAGG + Intronic
1118535177 14:66755731-66755753 AAAGAAAAGCATTCTAATTTGGG - Intronic
1118659958 14:67997472-67997494 AAAGTAAACTGTCATAATTTAGG - Intronic
1119581008 14:75781087-75781109 AGAGAAAAGCGTGCTAATTTGGG + Intronic
1119929461 14:78530766-78530788 ACAGTAAAACCTGAAAGTTTGGG - Intronic
1120161275 14:81147597-81147619 TAAGTGAAGCCTGATCATTGAGG + Intergenic
1120662080 14:87262166-87262188 AGATTAACACCTGATAATTTTGG + Intergenic
1120726666 14:87949814-87949836 AAAGTAAATTCTTATATTTTGGG - Intronic
1121195430 14:92067707-92067729 CAATTAAATCCTGAAAATTTGGG + Intronic
1122184086 14:99976390-99976412 AAAGACAAGACTGATAATTTTGG - Intronic
1122226095 14:100280932-100280954 AATTGGAAGCCTGATAATTTCGG + Exonic
1122351555 14:101097144-101097166 AATGAAAAGCCTTTTAATTTGGG - Intergenic
1124633603 15:31351253-31351275 AAAGTCAAGCATGTTAATTAAGG + Intronic
1126412866 15:48389795-48389817 AAAGAAAAGCCTGAAAGGTTGGG + Intergenic
1131607632 15:93925494-93925516 AATGTAAATCCTGGTAACTTTGG - Intergenic
1131628163 15:94146787-94146809 AATAGAAAGGCTGATAATTTAGG + Intergenic
1132267866 15:100492692-100492714 AAAGTAATTCCTGATAAAATAGG + Intronic
1132446161 15:101921151-101921173 AAAGTAAAGTTTGAAACTTTTGG + Intergenic
1133530288 16:6648792-6648814 AAAATACAGCCTGAGAATCTGGG + Intronic
1137067247 16:35860783-35860805 AAATTCAAGTCTGATAACTTTGG + Intergenic
1139209227 16:65059952-65059974 AAAGTGAAGCTACATAATTTGGG - Intronic
1141211933 16:81989507-81989529 AAATAAAAGCTTGATGATTTTGG + Exonic
1141248906 16:82337128-82337150 AAACTCTAGCCTGCTAATTTCGG + Intergenic
1144361550 17:14499561-14499583 AGAGCTAAGCCTGATGATTTAGG - Intergenic
1147416746 17:40297108-40297130 AAAGCAAAGCCTGATAAATAAGG + Intronic
1147908593 17:43840457-43840479 AAAGTCAAGCTTGACATTTTTGG - Intergenic
1148003661 17:44407233-44407255 AAAGCAAATCCTTCTAATTTGGG - Intronic
1148391899 17:47278839-47278861 AAACTAATGCCTGATGATCTGGG + Intronic
1149268885 17:54955494-54955516 AAAACAAAGCCTGATATTTTAGG + Intronic
1149876790 17:60242397-60242419 AAAGGAAACCCTTATATTTTTGG - Intronic
1152370282 17:79883560-79883582 AAAGAAAAACTTGATAACTTGGG - Intergenic
1154291054 18:13106916-13106938 AAAGGAAACCCAGATAATTTTGG - Intronic
1155301924 18:24437725-24437747 AAAGTAAGCCATGTTAATTTTGG + Intronic
1155898814 18:31362501-31362523 AAAATAAAGCAGGATAATTCAGG + Intergenic
1156315591 18:35966203-35966225 ACAGGAAAGCTTGATATTTTAGG + Intergenic
1158094021 18:53749633-53749655 AAAGTTAAACCTGATCAGTTTGG + Intergenic
1158650258 18:59277780-59277802 AAATTAAAGCAAGAAAATTTGGG + Intronic
1159323507 18:66886461-66886483 AAACTTTAGCCTGACAATTTTGG - Intergenic
1159784155 18:72693883-72693905 AATGTAAAACCTGATAAGTTGGG - Intergenic
1159816165 18:73076241-73076263 AGAATAGAGCCTGATTATTTGGG + Intergenic
1160639149 19:112565-112587 AAAGTAAAGTTTGAAACTTTTGG - Intergenic
1160784241 19:892347-892369 ACGGTGAAGCCTGAGAATTTAGG - Intronic
1163054135 19:14705808-14705830 TAACTAATGCCTGATAATTGAGG + Intronic
1164936054 19:32214434-32214456 AAAGCAAAACCTTTTAATTTTGG - Intergenic
925009233 2:469232-469254 TAGTTAAAGCCTGAGAATTTGGG - Intergenic
926238436 2:11067487-11067509 AAAGTAAAGCCGGAAAATCAGGG - Intergenic
926473721 2:13294639-13294661 AAAATAAAGCCTGGTAAACTTGG - Intergenic
926596288 2:14792589-14792611 AAAGTGAAGCACGGTAATTTGGG + Intergenic
928796039 2:35020772-35020794 AAAGTAAAGCAGTATAATATAGG - Intergenic
929105763 2:38364291-38364313 AAAGTATAGTCTGAGAATGTTGG + Intronic
929141682 2:38672006-38672028 AAAAAAAACCCTGATAATTATGG + Intronic
929310972 2:40424091-40424113 AAAGTAAAGCTTGAATATGTTGG + Intronic
929640804 2:43577717-43577739 AAAGTATAATTTGATAATTTAGG - Intronic
930537562 2:52663432-52663454 AAAGAAAAGGATGTTAATTTTGG - Intergenic
931460502 2:62446572-62446594 AAAGGAAAGCATGACAGTTTAGG - Intergenic
931548528 2:63415833-63415855 ATAGTAGAGCCTGTTAACTTTGG + Intronic
933569206 2:83989209-83989231 AAATTAAAACCTAATAAATTGGG - Intergenic
933861774 2:86476812-86476834 AAACTAAAGCTTGGTCATTTGGG + Intronic
935932218 2:108139542-108139564 AAATTAAATACTGATAATTTGGG + Intergenic
936676160 2:114717518-114717540 AAGGTAAAGATTTATAATTTAGG + Intronic
938078014 2:128351253-128351275 AAGAAAAAGACTGATAATTTAGG + Intergenic
941000636 2:160199482-160199504 AAAAAAGAGCATGATAATTTTGG - Intronic
941141771 2:161791965-161791987 AAAGTATAGCTTCATAATTTGGG + Intronic
941406587 2:165097280-165097302 AAAGTAAACTTTGATAATGTTGG - Exonic
941480429 2:166002500-166002522 AAAGTAAACTTTGATAATGTAGG - Exonic
941481197 2:166015749-166015771 AAAGTAAAGTCCTTTAATTTTGG + Intronic
942160722 2:173183872-173183894 AAAGGAAAGACTGCTACTTTTGG - Intronic
942577223 2:177376719-177376741 AAACTAAAGGATGATTATTTAGG - Intronic
942679395 2:178461332-178461354 AAAGCAAACCTAGATAATTTAGG - Exonic
942834700 2:180279817-180279839 AAAGCAAAGCTTGACAATATGGG + Intergenic
943384417 2:187184030-187184052 GAAGTAAAGCCTTAGCATTTTGG + Intergenic
943698942 2:190968662-190968684 AAATTAAAAACTGCTAATTTGGG + Intronic
944863475 2:203837945-203837967 AAAGAAAAGCCTTAAATTTTTGG + Intergenic
946466608 2:219917734-219917756 AAAAAAAAGCCAGATAATTTGGG - Intergenic
946682857 2:222235605-222235627 AATGAAAAGCCTCAGAATTTGGG + Intronic
1169301790 20:4448607-4448629 AAAGAAAAGTTTGATAAATTAGG + Intergenic
1169683563 20:8244594-8244616 AAAGGGGTGCCTGATAATTTTGG + Intronic
1170593586 20:17789391-17789413 AAAGAAAAGCTGGATAAATTGGG - Intergenic
1170762522 20:19263434-19263456 TAAAAAAAGCCTGATTATTTAGG + Intronic
1170896135 20:20416191-20416213 AAAGAAAAGCATGATAAATCTGG + Intronic
1173957202 20:47042859-47042881 AAAGCAAAACCTGAAAACTTCGG - Intronic
1174158095 20:48529567-48529589 GAATAAAAGCCTGGTAATTTGGG - Intergenic
1177073835 21:16546478-16546500 AAAGTTAAACTAGATAATTTGGG + Intergenic
1177114516 21:17069648-17069670 ATAGTAAAGCCTGTAAATGTAGG - Intergenic
1177346735 21:19882941-19882963 AAAGTATAGCCTCATAAAATGGG + Intergenic
1177347068 21:19887136-19887158 AAAGAAAAGCCTTATAAATATGG - Intergenic
1177368160 21:20166300-20166322 AAAGAAAAGACAGATATTTTTGG + Intergenic
1177604669 21:23361801-23361823 AAGGTAATGATTGATAATTTGGG + Intergenic
1177731850 21:25037401-25037423 AACATAAAGCCTGAGAATCTTGG - Intergenic
1178036073 21:28584529-28584551 AAAGCAAAACCTTTTAATTTAGG + Intergenic
1178450562 21:32695602-32695624 AAAGTAGAGCTTCATAAATTGGG - Intronic
1182156292 22:28076161-28076183 AAAGTAAAACCTTATCAATTTGG + Intronic
951407911 3:22323903-22323925 AAGGCAAAGCCTGACAAATTTGG - Intronic
951832463 3:26945530-26945552 AATGTATAGGCTGTTAATTTGGG - Intergenic
953517358 3:43607774-43607796 AAAGACAAGATTGATAATTTTGG + Intronic
955322960 3:57987496-57987518 AAAGCAAAACATGAGAATTTAGG - Intergenic
956119129 3:65948355-65948377 AAAGAAAAGGCAGAAAATTTGGG - Intronic
956243679 3:67156964-67156986 AAAGTATATTCTGATGATTTGGG - Intergenic
956459527 3:69457372-69457394 AAAGTAAAGCATGTTTATTATGG - Intronic
957207762 3:77219365-77219387 AAAATAAAGCTTAATAAGTTTGG - Intronic
957961887 3:87266570-87266592 AAAGTAAACCTGGATAATTTTGG - Intronic
958029673 3:88093132-88093154 AAACTGAAGCCTGAAAAGTTGGG + Intronic
958564024 3:95783497-95783519 CAAGAAAAGCATGATGATTTGGG - Intergenic
959205022 3:103296838-103296860 CAAGTAAAGGCTCATATTTTTGG - Intergenic
959209664 3:103361660-103361682 AAAGTATTGTATGATAATTTTGG - Intergenic
960177560 3:114534667-114534689 AAAGTATATTCTGTTAATTTGGG - Intronic
960776319 3:121259622-121259644 AAAGAATAGAGTGATAATTTAGG - Intronic
961032822 3:123621506-123621528 TCAGTAAAGCCTCACAATTTAGG + Intronic
961055449 3:123784583-123784605 AAAGTAAATCCTGTAAGTTTTGG - Intronic
961841027 3:129712241-129712263 AAACAAAAGCCTTATAACTTTGG - Intronic
962139138 3:132769859-132769881 AAAGCAAAGGTTGATAAATTAGG + Intergenic
964095014 3:152921226-152921248 AAAGAAAAATATGATAATTTAGG - Intergenic
964540821 3:157777685-157777707 AAAATAATCCCTGATAATTATGG - Intergenic
964643575 3:158934889-158934911 CAAATAAAGCCTGATCAGTTGGG - Intergenic
965051635 3:163657149-163657171 AAAGAAAATTCTTATAATTTTGG + Intergenic
965107082 3:164370321-164370343 AAAGCAAAGCCTGTTTATATAGG - Intergenic
965171681 3:165273661-165273683 AAGATTAAGCCTGATATTTTAGG + Intergenic
965685467 3:171297548-171297570 TAATTAAAAACTGATAATTTGGG - Intronic
966095824 3:176201774-176201796 AAAGTAAAGAGTGAAAGTTTGGG - Intergenic
966927762 3:184656610-184656632 AAAGCCAAGCCTGATCATCTTGG + Intronic
967022932 3:185538584-185538606 AAAATAAAGCTTAATAGTTTGGG - Intronic
967267792 3:187706046-187706068 TAAGCAAAGCCTGATCATTTTGG - Intronic
971461951 4:26908910-26908932 AAATGAAAGACTGATATTTTTGG + Intronic
971787798 4:31127053-31127075 AAAGTCAAACCTGAAAATATTGG + Intronic
972518132 4:39828907-39828929 AAATAAAAGACTGATAAATTGGG + Intronic
973581320 4:52347134-52347156 GAGGTAAAGACTGATTATTTAGG + Intergenic
973794005 4:54405420-54405442 TATGTAAAGGCTGAAAATTTGGG + Intergenic
974205106 4:58691866-58691888 AAAATAAACCCTTATATTTTTGG + Intergenic
974390001 4:61254069-61254091 AAAAGAAAGCTTGCTAATTTGGG + Intronic
975272341 4:72450486-72450508 AGAGCAAAGAATGATAATTTGGG - Intronic
975456925 4:74602516-74602538 AAAGTAATGCCTCATATTTAGGG - Intergenic
975876166 4:78839504-78839526 AAAGTGAAGTTTGAAAATTTAGG + Intronic
976169606 4:82289373-82289395 AAAGTAAAACCTGAAACTCTTGG - Intergenic
976429254 4:84944206-84944228 AAAGTTAGGAGTGATAATTTTGG - Intronic
976719559 4:88156486-88156508 AAATTAAATACTGATAATATTGG + Intronic
978228527 4:106368170-106368192 AAAGTAAAGCCTAACATATTGGG + Intergenic
978371613 4:108035144-108035166 AAAGTAAAAGTTGGTAATTTAGG + Exonic
978468208 4:109031618-109031640 AAAGTAAAGCTTTAAAATGTGGG - Intronic
978643399 4:110898241-110898263 AAAGAAAAGCATGATATTTGGGG - Intergenic
978921349 4:114186853-114186875 AGAGTAAAGCCTGATAAAAATGG + Intergenic
979200601 4:117973437-117973459 ACATGACAGCCTGATAATTTTGG - Intergenic
979353036 4:119668370-119668392 AAAATTAATCATGATAATTTAGG - Intergenic
980192299 4:129540693-129540715 AAAGTAGAGCCTGAGAGTTGGGG - Intergenic
980462817 4:133138815-133138837 AAAGTAAGGCTTGAAAATTTTGG - Intergenic
980467436 4:133203950-133203972 TAAGAAAAGCCTAAGAATTTTGG + Intronic
981653291 4:147083322-147083344 AAAATAAACCCGGAGAATTTTGG + Intergenic
981871399 4:149491094-149491116 AAAGTCAAAGCTGGTAATTTAGG - Intergenic
982404311 4:155003036-155003058 AAAAAAAAGTCTGATATTTTGGG + Intergenic
982604171 4:157492636-157492658 TAATTAAAGCCTTATATTTTTGG + Intergenic
982635774 4:157895121-157895143 AAAGTAGAGCCTGAGAAGATGGG + Intergenic
982818001 4:159909984-159910006 AATGTACAGCATGATAATTATGG + Intergenic
983328871 4:166297795-166297817 AAGGTAAAGGCAGAAAATTTTGG - Intergenic
984319822 4:178179806-178179828 GAAGTAAAGCTTGATAACTCTGG + Intergenic
984375854 4:178927980-178928002 AAAGGATAGTTTGATAATTTTGG - Intergenic
984800309 4:183709796-183709818 AAAGAAAAATCTCATAATTTTGG + Intronic
985204447 4:187520034-187520056 AAAGTGAAGCCTGGGAATTCAGG - Intergenic
986167067 5:5283068-5283090 TAAGTCAATACTGATAATTTTGG + Intronic
986649255 5:9947555-9947577 CAAGTACAGCCTGATAAGTGGGG + Intergenic
990090407 5:52039479-52039501 AAAAAAAAGCTGGATAATTTAGG - Intronic
990341454 5:54827166-54827188 AAATTAGAGCCTGATATCTTTGG - Intergenic
990751026 5:59016371-59016393 AAAGAACAGACTGATAATCTAGG - Intronic
991068706 5:62453210-62453232 AAGGAAAAGCCCGCTAATTTAGG - Intronic
992569074 5:78034499-78034521 AAACTAAACACTGAAAATTTAGG + Intronic
992751772 5:79868989-79869011 AAAGTAAAGCAAGTTGATTTGGG + Intergenic
993097538 5:83497354-83497376 AAATTAAATCCTGCTAGTTTTGG + Intronic
993449012 5:88051546-88051568 AAAATAAAGCCTCCAAATTTGGG + Intergenic
993932463 5:93956515-93956537 GAAGTAAATTCTGATATTTTGGG - Intronic
993946665 5:94123572-94123594 GAACTAAAGAGTGATAATTTAGG - Intergenic
994232677 5:97326101-97326123 AAATCAAAGGGTGATAATTTTGG - Intergenic
994545880 5:101165523-101165545 AATGTAAACTCTGTTAATTTGGG - Intergenic
994797593 5:104324325-104324347 AAATTAAAGCCTGATATCTTTGG + Intergenic
994921946 5:106057509-106057531 AAAATAAAACCTCATAACTTTGG - Intergenic
995850788 5:116543848-116543870 AAAGTAAAACGTGCTAGTTTTGG - Intronic
995888835 5:116926743-116926765 AAAGTAAAGGCGGATGATTATGG + Intergenic
996240079 5:121187720-121187742 ATAGTAAAATCTAATAATTTGGG + Intergenic
998273572 5:140729832-140729854 AAAATAATGCCTGTTTATTTTGG + Intergenic
998582103 5:143387340-143387362 AAATCAAAGCCAGATAAATTAGG - Intronic
999394203 5:151216392-151216414 AAAAAAAATCCTAATAATTTAGG - Intronic
1000013353 5:157254655-157254677 AAAGTAAACAGAGATAATTTTGG - Exonic
1000744226 5:165011642-165011664 AAAGGAAAGCATGATAAAATAGG - Intergenic
1000765504 5:165284495-165284517 CAAGAAAATCCTGAAAATTTGGG - Intergenic
1002746500 6:60970-60992 AAAGTAAAGTTTGAAACTTTTGG - Intergenic
1003714604 6:8632283-8632305 TAAGTAATGCCTGATGATCTAGG - Intergenic
1003927887 6:10894680-10894702 AGAATAAAAGCTGATAATTTGGG - Intronic
1004863947 6:19836229-19836251 AAAAAAAAGCCTGTTAATTAAGG - Intergenic
1004975977 6:20966851-20966873 AAAATAAAGACTGAAAATGTAGG - Intronic
1005632348 6:27720340-27720362 GAAGAAAAGACTGATAACTTTGG + Intergenic
1006005636 6:30999823-30999845 TATGTAAAGCCTGGTAATTTGGG - Intergenic
1008334192 6:50280732-50280754 AAAGTTAAGACTGATATTTATGG + Intergenic
1008779982 6:55091707-55091729 AAAGTATAGTCTGTTTATTTGGG - Intergenic
1009802681 6:68561080-68561102 TCATTAAAGCCTAATAATTTCGG + Intergenic
1009998925 6:70927863-70927885 AAAGTATATTCTGTTAATTTTGG - Intronic
1010119133 6:72353303-72353325 AAAGTAAAGTCTGAAAATACTGG + Intronic
1010632581 6:78216402-78216424 AAAGTCTAACATGATAATTTTGG + Intergenic
1011052358 6:83167076-83167098 AATATAAAGACTAATAATTTGGG - Intronic
1011164786 6:84433824-84433846 GGAGGAAAGCCTGGTAATTTTGG + Intergenic
1013491393 6:110649495-110649517 AAAGAAAAGACTGATAAATTTGG + Intronic
1013756507 6:113467985-113468007 AAATTAATGCCTGATACTCTTGG + Intergenic
1013831765 6:114280995-114281017 AAAGATAAGCCTTATAAGTTTGG + Intronic
1014610939 6:123545091-123545113 ATGCTACAGCCTGATAATTTAGG + Intronic
1014790251 6:125664374-125664396 AAAGTAATGCCTGCTAATGACGG + Intergenic
1014824736 6:126036266-126036288 AAGGGAAAGCCTGAGAATTATGG + Intronic
1015939690 6:138435380-138435402 AAACAAAATCCTGATACTTTTGG + Intronic
1016194891 6:141323007-141323029 AAAGTAAAACTTGATCATTTAGG + Intergenic
1017486179 6:154903610-154903632 AAAGAAAAGGCATATAATTTTGG + Intronic
1018627900 6:165797682-165797704 ATACTATAGCCTGAAAATTTAGG + Intronic
1018795679 6:167183816-167183838 GATGTAAAGCCTGATTATTGTGG - Intronic
1018820638 6:167371247-167371269 GATGTAAAGCCTGATTATTGTGG + Intronic
1020579695 7:9980485-9980507 AAAGTAGAGTCAGAAAATTTGGG - Intergenic
1021334121 7:19377632-19377654 AAAGTTATGGCTCATAATTTTGG + Intergenic
1021903583 7:25311698-25311720 GAAGCAAAGCCTGATACGTTAGG + Intergenic
1021997094 7:26189885-26189907 AAAGTAAAGCCAGAAACTTTAGG + Intergenic
1022641734 7:32192222-32192244 AAAGTAAAAATTGATAAATTGGG - Intronic
1022997840 7:35776303-35776325 AAATTAAAACCTGATATTTCAGG - Intergenic
1023154020 7:37229865-37229887 AAAGTAAAGACTGACAGTCTTGG - Intronic
1023199795 7:37684101-37684123 AAAGTAAAACCTAATATTTATGG + Intronic
1023614209 7:42002412-42002434 AAAGTAAAACCTGTTAAAATAGG + Intronic
1023679482 7:42670565-42670587 AAAATAAAACTTGATAACTTTGG + Intergenic
1024342801 7:48284109-48284131 TAAGTAAAAACTGGTAATTTAGG + Intronic
1024847276 7:53661425-53661447 GAAGAAAAGTCTGTTAATTTAGG - Intergenic
1025607628 7:63050833-63050855 AAAGAAAAGACTGTTAATATAGG - Intergenic
1026963251 7:74423268-74423290 AAAGCAGAGCCAGAGAATTTGGG + Intergenic
1028263795 7:88697600-88697622 AATGCAAGGCCTGATCATTTTGG + Intergenic
1028648934 7:93128912-93128934 AAAGTAAATCTTGAAAATCTTGG + Intergenic
1030575413 7:111280130-111280152 AAGGGAAAGCCAGATCATTTAGG - Intronic
1030654621 7:112153025-112153047 AAATTAAAGCCTAAAAAGTTTGG + Intronic
1030791405 7:113733491-113733513 AAAGAAAAAACTGATAAATTTGG - Intergenic
1031038341 7:116812696-116812718 AAATTAAACCCTGATCCTTTTGG - Intronic
1031635956 7:124101136-124101158 AAATTAAATACTGATAATCTGGG - Intergenic
1031683272 7:124701119-124701141 AAAGTAAAACCTGAGGATTTGGG + Intergenic
1032233826 7:130102131-130102153 AAAATACAGCCTGCCAATTTTGG + Intronic
1032790640 7:135240067-135240089 AAAGTAAAGCCTGAGATCTCAGG + Intronic
1033193164 7:139302137-139302159 AAAGTACAGACTGATAAGTCAGG + Exonic
1033245206 7:139712078-139712100 ACAGTAAAGCCTGAGAACCTGGG + Intronic
1033385095 7:140865712-140865734 AAGGAAAAGGCTGATGATTTAGG + Intronic
1035000088 7:155605579-155605601 ACAAAAAAGCCTGATAAATTGGG + Intergenic
1036015907 8:4784250-4784272 AAGGTAAAGCCTGTTTACTTGGG - Intronic
1036025012 8:4897083-4897105 AAAGTCAAGCCTGAAATTGTAGG - Intronic
1039486091 8:37911097-37911119 AAAGAAAAGATTGATCATTTGGG - Intergenic
1042015751 8:64308624-64308646 AAGGTAAAGCATGACTATTTGGG + Intergenic
1042054062 8:64744023-64744045 AAAGATAAGCATGAGAATTTTGG + Intronic
1042170134 8:65983339-65983361 AAAGTGAGGCCTGAAAATTTTGG + Intergenic
1042358208 8:67852967-67852989 AAAGTGAAGTCTGAAAAGTTAGG + Intergenic
1042761937 8:72280653-72280675 AAAGTACAGCCTGGTATTTAAGG - Intergenic
1042948154 8:74175377-74175399 AAAGCAAAGCATGATAAATTTGG - Intergenic
1043724500 8:83592344-83592366 AAAGTATAGGCTGAAAATTGTGG - Intergenic
1044207402 8:89507325-89507347 AAGGGAAAGACTGATAATTTGGG + Intergenic
1044288712 8:90441779-90441801 AGAGTGAAGCCTGATAAATGAGG - Intergenic
1046320615 8:112569367-112569389 AAAATAAACCCTGATTGTTTAGG + Intronic
1046490741 8:114950580-114950602 AAAGTAAAGTGAGATAATATGGG + Intergenic
1046805863 8:118478325-118478347 GCAGTTAAGCCTGATAATTCAGG - Intronic
1046937487 8:119898733-119898755 AAAAAAAAGCCTTATATTTTAGG + Intronic
1050240331 9:3627405-3627427 AACATAAAACCTGATAAGTTTGG - Intergenic
1050447652 9:5742721-5742743 AAAATAAATCCTGGTCATTTAGG - Intronic
1050943678 9:11490810-11490832 TAATGAAAGCCTGATATTTTGGG + Intergenic
1052029159 9:23609107-23609129 AAAGTAACACATAATAATTTAGG + Intergenic
1052153232 9:25147051-25147073 GAAATAAATCCTGATAATTATGG + Intergenic
1052164799 9:25312228-25312250 AAACCAAAGCATGATAATGTAGG + Intergenic
1052647758 9:31258856-31258878 AAAGTATAGCCAGATAATATGGG - Intergenic
1053092630 9:35293337-35293359 AAAGTAAAACCTGTGGATTTGGG + Intronic
1053508438 9:38666775-38666797 AATGTAAAAGTTGATAATTTTGG + Intergenic
1055128398 9:72746590-72746612 TCAGTAAAGGCTGTTAATTTTGG - Intronic
1055698329 9:78913632-78913654 AATGTCAAGCCTGATTATATTGG + Intergenic
1055752629 9:79523871-79523893 AAATTAGACCCTGAGAATTTAGG + Intergenic
1056173643 9:84012929-84012951 TAATTAAAGCCTGATGATCTGGG - Intergenic
1058197360 9:101994573-101994595 AAAGTAAACCCTCACATTTTTGG - Intergenic
1058489129 9:105477010-105477032 AATGAAAAGCCAGATAATCTAGG - Intronic
1058532374 9:105919328-105919350 TTAGTAAAGCCTCCTAATTTTGG - Intergenic
1058851497 9:109015541-109015563 GAAGCAAATCCTGATAATTTTGG - Exonic
1059009980 9:110446686-110446708 AAATTAAAGCTTAAAAATTTAGG - Intronic
1060947996 9:127581666-127581688 AAAGTAAAATTTGATGATTTGGG + Intergenic
1061165616 9:128920556-128920578 AAAGTAAGGCCTGAACATCTGGG + Intergenic
1062301606 9:135875916-135875938 AAAGGAAATACTGATAAATTGGG + Intronic
1186285260 X:8036851-8036873 TGAGTAAAGCCTTATAATGTAGG - Intergenic
1187101497 X:16197508-16197530 AAAATAAAGCCACACAATTTTGG - Intergenic
1188686103 X:33072514-33072536 AAAGTAATTCCTGAGAAATTTGG + Intronic
1188990218 X:36809763-36809785 AAAGAAAAGACTGTTAATGTTGG - Intergenic
1189039217 X:37524750-37524772 ATAGTAAACCCTGAAAATTGGGG + Intronic
1190749737 X:53351432-53351454 AAAGAAAAAACTGATAAATTTGG + Intergenic
1191010923 X:55758090-55758112 AAATTAAACCTTGATAACTTGGG + Intronic
1191684593 X:63876852-63876874 AAAGAAAAACGTGATAATCTGGG + Intergenic
1191824166 X:65346535-65346557 AATGTAAAAAATGATAATTTTGG - Intergenic
1193390464 X:80921494-80921516 AAAGTTAAACTTGATGATTTGGG + Intergenic
1194405550 X:93492180-93492202 AAAGTAAAGCATAATTATTGGGG + Intergenic
1195160574 X:102166883-102166905 AAAGTAAACCCTGAAAAAATTGG + Intergenic
1196050893 X:111302978-111303000 AAAATAAAAACTGATAAATTGGG - Intronic
1196578151 X:117345822-117345844 CAAGTAAAACCTATTAATTTGGG + Intergenic
1198031324 X:132756161-132756183 AAAGTAAAGGATGATCATTTTGG - Intronic
1198073828 X:133176039-133176061 AAACTAAGGCCTTAAAATTTTGG - Intergenic
1198200965 X:134418299-134418321 AAAGTAAAGTATGAAGATTTGGG + Intronic
1200786075 Y:7261561-7261583 AGAGTAAAGCCTGCCAAATTAGG - Intergenic
1201916588 Y:19188594-19188616 AATGTATATTCTGATAATTTGGG + Intergenic
1202355328 Y:24042267-24042289 ACAGAAAAGCCTGGAAATTTTGG + Intergenic
1202515450 Y:25627842-25627864 ACAGAAAAGCCTGGAAATTTTGG - Intergenic