ID: 1069323397

View in Genome Browser
Species Human (GRCh38)
Location 10:67201711-67201733
Sequence CCTCCATTTCACATGTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069323395_1069323397 14 Left 1069323395 10:67201674-67201696 CCTAAATTATCAGGCTTTACTTT 0: 1
1: 0
2: 0
3: 33
4: 370
Right 1069323397 10:67201711-67201733 CCTCCATTTCACATGTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069323397 Original CRISPR CCTCCATTTCACATGTTTAA AGG Intronic
No off target data available for this crispr