ID: 1069328653

View in Genome Browser
Species Human (GRCh38)
Location 10:67263511-67263533
Sequence GCACCTATTCATTATAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069328652_1069328653 -7 Left 1069328652 10:67263495-67263517 CCATCATTTGTTACAAGCACCTA 0: 1
1: 0
2: 0
3: 13
4: 118
Right 1069328653 10:67263511-67263533 GCACCTATTCATTATAAAAAAGG No data
1069328650_1069328653 25 Left 1069328650 10:67263463-67263485 CCAAGGGGTATATTAACAAGGGC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1069328653 10:67263511-67263533 GCACCTATTCATTATAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069328653 Original CRISPR GCACCTATTCATTATAAAAA AGG Intronic
No off target data available for this crispr