ID: 1069332180

View in Genome Browser
Species Human (GRCh38)
Location 10:67305697-67305719
Sequence CACATCTACCACTCTAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 7, 3: 57, 4: 326}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069332180_1069332184 13 Left 1069332180 10:67305697-67305719 CCTGCACTAGAGTGGTAGATGTG 0: 1
1: 0
2: 7
3: 57
4: 326
Right 1069332184 10:67305733-67305755 GTAGCTTCATTTGAGAGATTAGG No data
1069332180_1069332186 30 Left 1069332180 10:67305697-67305719 CCTGCACTAGAGTGGTAGATGTG 0: 1
1: 0
2: 7
3: 57
4: 326
Right 1069332186 10:67305750-67305772 ATTAGGGAAGCAGACTCAATAGG No data
1069332180_1069332185 14 Left 1069332180 10:67305697-67305719 CCTGCACTAGAGTGGTAGATGTG 0: 1
1: 0
2: 7
3: 57
4: 326
Right 1069332185 10:67305734-67305756 TAGCTTCATTTGAGAGATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069332180 Original CRISPR CACATCTACCACTCTAGTGC AGG (reversed) Intronic
900024340 1:207042-207064 AACCTCTACCACCCAAGTGCTGG + Intergenic
902424924 1:16312707-16312729 CACATGTACCACTCTGGTGGGGG + Intronic
903727731 1:25463954-25463976 CAAATGTACCACTCTGGTGGGGG - Intronic
904115262 1:28157050-28157072 CACATGTTTCACTCTAGTCCTGG - Intronic
904518589 1:31076494-31076516 CAAATGTACCATTCTGGTGCTGG + Intergenic
905578777 1:39067482-39067504 CAAATGTACCACTGTAGTGTGGG - Intergenic
906806372 1:48782718-48782740 CAGATATACCACTCTGGTGGGGG - Intronic
907547203 1:55272559-55272581 CAGATATACCACTCTGGTGCAGG - Intergenic
907965705 1:59326778-59326800 AACATCTATCACTCTACTACAGG + Intronic
909471083 1:76028879-76028901 CAAATGTACCACTCTCGTGGAGG + Intergenic
909510367 1:76446284-76446306 CAAATATACCACTCTAGTAATGG - Intronic
910097428 1:83539347-83539369 CAAATGTACCACTCTGGTGGGGG + Intergenic
910338621 1:86160327-86160349 GAAATCTAACACTCTAGTTCTGG - Intergenic
910978410 1:92932974-92932996 CATATGTACCACTCTGGTGAGGG + Intronic
911375129 1:97043357-97043379 CTCCTCTCCCACTCAAGTGCTGG + Intergenic
911579206 1:99615983-99616005 CAAATGTACCACCCTGGTGCTGG + Intergenic
911813739 1:102315809-102315831 CAAATGTACCACTCTTGTGAGGG + Intergenic
912677329 1:111695964-111695986 CAAATGTACCACTCTGGTGCAGG + Intronic
914427794 1:147594512-147594534 CACATCTACAAGTCTAGCTCAGG - Intronic
914993990 1:152524305-152524327 CAAATGTACCACTCTGGTGGGGG - Intronic
915982785 1:160431919-160431941 CAAATGTACCACTCTGGTGGGGG + Intergenic
916052595 1:161046979-161047001 CACAGGTCCCACTCTAGTGAAGG - Exonic
916498116 1:165363705-165363727 CACAATTACCACTCTAATCCAGG - Intergenic
916923411 1:169492751-169492773 CACCACTACCACCCTAGTTCAGG + Intergenic
916949062 1:169760292-169760314 TAAATGTACCACTCTGGTGCGGG - Intronic
917003723 1:170388545-170388567 CTCCTCTCCCACTCAAGTGCTGG + Intergenic
917585139 1:176418220-176418242 CAAATGTACCACTCTAATGGAGG - Intergenic
917616360 1:176749395-176749417 CAAATGTACCACTCTGGTGGGGG - Intronic
918557614 1:185822248-185822270 CAAATGTACCACTCTGGTGGGGG + Intronic
918646539 1:186912259-186912281 CAAATGTACCACTCTGGTGTGGG - Intronic
919633473 1:199981633-199981655 CAAATGTACCACTCTGGTGGGGG - Intergenic
920507748 1:206528601-206528623 CAAATGTACCACTCTGGTGGGGG + Intronic
920805111 1:209225852-209225874 CAAATTTACCACTCTAGTTGGGG + Intergenic
920986819 1:210898457-210898479 CACATTTACCACTCACTTGCAGG - Intronic
921537197 1:216366347-216366369 CAAATATACCACTCTGGTGCAGG + Intronic
923112971 1:230907733-230907755 CATAGCAACCACTCTATTGCTGG - Intronic
923247682 1:232148597-232148619 CAAATGTTCCACTCTGGTGCAGG + Intergenic
923627430 1:235625381-235625403 CAAATGGACCACTCTGGTGCAGG - Intronic
923940756 1:238823114-238823136 CAAATGTATCACTCTAGTGGGGG + Intergenic
1065828550 10:29594458-29594480 CGTATGTACCACTCTAGTGGGGG + Intronic
1067383656 10:45798546-45798568 TAAATGTACCACTCTGGTGCAGG + Intergenic
1067880523 10:50040255-50040277 TAAATGTACCACTCTGGTGCAGG - Intergenic
1067891358 10:50139113-50139135 TAAATGTACCACTCTGGTGCAGG + Intergenic
1068295270 10:55062779-55062801 CATATGTACCACTCTAGTGGAGG + Intronic
1068456576 10:57262095-57262117 CTCATCTACAATTCTACTGCAGG + Intergenic
1069332180 10:67305697-67305719 CACATCTACCACTCTAGTGCAGG - Intronic
1070204299 10:74241325-74241347 CAAATGTACCACTCTGGTGGGGG - Intronic
1070245286 10:74725390-74725412 CAAATATACCACTTTTGTGCAGG + Intergenic
1071305674 10:84296932-84296954 CACATCTGCCACTGGTGTGCTGG - Intergenic
1072278715 10:93846774-93846796 CACCTCTAAAACTCTAGTGCTGG - Intergenic
1072528122 10:96292757-96292779 CAAATGTACCACTCTGGTGGGGG - Intergenic
1072571455 10:96661486-96661508 CAAATGTGCCACTCTGGTGCTGG + Intronic
1072942264 10:99776731-99776753 CAAATGTACCACTCTGGTGGGGG - Intergenic
1073529110 10:104215432-104215454 CACATCAACCACACTCTTGCTGG + Intronic
1074821258 10:117180599-117180621 CAAATGTACCACTCAAGTGTGGG - Intergenic
1076698223 10:132257216-132257238 CACACCTACCCATCTCGTGCTGG - Intronic
1077777649 11:5289262-5289284 CACTTCTACCTCTCAAGTGCTGG + Intronic
1082727650 11:56755813-56755835 CACGTCCACCAGTCTAGAGCTGG - Intergenic
1083340179 11:61954247-61954269 TAAATCTACCACTGTAGTGTGGG - Intronic
1084579123 11:70011487-70011509 CACATCACCCACTCTGGTACTGG + Intergenic
1084924200 11:72498854-72498876 CAAATGTACCACTCTGGTGGGGG - Intergenic
1085162155 11:74358201-74358223 CATATGTACCACTCTAATGGGGG + Intronic
1086011039 11:82103776-82103798 CCAATGTACCACTCTGGTGCAGG + Intergenic
1086159809 11:83709532-83709554 TACATTTACCACCCCAGTGCTGG + Intronic
1086392254 11:86376754-86376776 CACATGTACCACTCCGGTGAGGG - Intronic
1087869569 11:103275297-103275319 CAAGTGTACCACTCTGGTGCAGG - Intronic
1088523329 11:110723728-110723750 CAAATATACCACTCTGGTGACGG - Intergenic
1088704121 11:112446244-112446266 CAAATGTACCACTCTGGTGAGGG - Intergenic
1089394628 11:118128292-118128314 CCCATGTACCACTCTGGTGGGGG - Intergenic
1091378037 12:38577-38599 AACCTCTACCACCCAAGTGCTGG + Intergenic
1091464613 12:673099-673121 CAAATGTACCACTCTGGTGTGGG - Intergenic
1092775337 12:11940161-11940183 CAAACGTACCACTCTGGTGCTGG + Intergenic
1093652612 12:21661881-21661903 CCCATCTACCACCCAAGGGCTGG + Intronic
1093878249 12:24374856-24374878 CACAAATCTCACTCTAGTGCAGG - Intergenic
1094321890 12:29193195-29193217 CAAATATACCACTCTTGTGTAGG - Intronic
1095522000 12:43077663-43077685 CAAATGTACCACTCTGGTGGGGG + Intergenic
1096076206 12:48806870-48806892 CAAATTTACCACTCTGCTGCAGG + Intergenic
1096564344 12:52464947-52464969 CAAATGTACCACTCTGGTGGGGG + Intergenic
1098285284 12:68900995-68901017 CAAATGTACCACTCTGGTGGGGG + Intronic
1098656398 12:73035708-73035730 CAAATGTACCACTCTAGTGGAGG - Intergenic
1100076430 12:90790168-90790190 CAGATGTACCACTCTGGTGGGGG + Intergenic
1100082819 12:90873983-90874005 CAAATGTACCACTCTGGTGGGGG + Intergenic
1100911758 12:99372171-99372193 CACATGTACCACTCTAGTGGGGG + Intronic
1102896935 12:116605750-116605772 CAAATGTACCACTCTGGGGCAGG - Intergenic
1103364808 12:120374093-120374115 CAAATGTACCACTCTGGTGGGGG - Intergenic
1105643739 13:22294145-22294167 CAAATGTACCACTCTAATGGTGG - Intergenic
1105670471 13:22607986-22608008 CAAATGCACCACTCCAGTGCAGG + Intergenic
1106175214 13:27324481-27324503 TACATATACCACTCTGGTTCAGG + Intergenic
1106229687 13:27812252-27812274 CACAGCTACCACCCTAGTGCAGG - Intergenic
1106939268 13:34759178-34759200 CAAATGTCCCACTCTGGTGCTGG - Intergenic
1106970156 13:35130105-35130127 CAAATGTACCACTCTGGTGAGGG + Intronic
1110269053 13:73572518-73572540 CACATCTACCTCTCCAATTCTGG + Intergenic
1110303925 13:73962522-73962544 CAAATGTACCACTGTCGTGCAGG + Intronic
1112220085 13:97479756-97479778 CACATGCACCACTCTGGTGCAGG - Intergenic
1112679416 13:101745303-101745325 CAAGTATACCACTCTAGTGCAGG - Intronic
1114358604 14:21943513-21943535 CAAATGTACCACTCTGGTGGTGG - Intergenic
1114764833 14:25359106-25359128 CAAATGTACCACTCTGGTGGAGG - Intergenic
1114920557 14:27322560-27322582 CAAATCTACCACTCTGGTGGTGG - Intergenic
1115733023 14:36292474-36292496 CACATGTACCACTCTGATGAGGG - Intergenic
1115833944 14:37376136-37376158 CAAATGTACCACTCTGGTGCAGG - Intronic
1117195303 14:53334267-53334289 CAAATGTAGCACTCTGGTGCAGG - Intergenic
1117417484 14:55510562-55510584 CAAATGTACCACTCTGGTGATGG - Intergenic
1117943727 14:60996070-60996092 CAAATGTACCACTCTGGTGCAGG + Intronic
1118131722 14:62973050-62973072 CAGATGTACCACTCTGGTGTGGG + Intronic
1118717017 14:68567432-68567454 CAAATGTACCACTCTGGTGTGGG - Intronic
1119197737 14:72729964-72729986 CAAATGCACCACTCTAGTGGAGG + Intronic
1120753775 14:88222588-88222610 CAAATGTACCAGTCTGGTGCGGG + Intronic
1120790412 14:88575578-88575600 CACATCCACCTCTCCAGTCCAGG - Intronic
1121225234 14:92316932-92316954 CACTTCTACTACTCTGGTGGAGG + Intergenic
1122706028 14:103622206-103622228 CGAATGTACCACACTAGTGCAGG + Intronic
1124530997 15:30506429-30506451 CAAATGTACCACTCTGGTGTGGG + Intergenic
1124767658 15:32501266-32501288 CAAATGTACCACTCTGGTGTGGG - Intergenic
1125242306 15:37589381-37589403 CATATGTACCACTCTGATGCAGG - Intergenic
1126846789 15:52767394-52767416 CTCAGCTACCATTCTAGTTCAGG - Intronic
1127101464 15:55569813-55569835 CATATCTACCACTCCACAGCAGG + Intronic
1128023177 15:64411351-64411373 CAAATGTACCACTCTGGTGAGGG + Intronic
1129047986 15:72753954-72753976 CAAATGTACCACTCTGGTGCAGG + Intronic
1129929421 15:79397935-79397957 CAAATATACCACTCTGGTGCAGG - Intronic
1130736165 15:86552178-86552200 CAAACCTACCACTCTGGTGAGGG + Intronic
1131633425 15:94204176-94204198 CACATATGCCACTCTTGTGGAGG + Intergenic
1134138338 16:11695623-11695645 CACCTCTACCACCCAAGTTCAGG + Intronic
1134797407 16:17054056-17054078 CTCCTCTCCCACTCAAGTGCTGG + Intergenic
1136400514 16:30015063-30015085 CACAGTTACCATTCTTGTGCAGG - Intronic
1137692621 16:50440145-50440167 CAAATGTACCACTCTGGTGGGGG + Intergenic
1138671912 16:58622316-58622338 AAAATGTACCACTCTAGTGGGGG + Intronic
1139499959 16:67354706-67354728 CAAATGTACCACTCTGGGGCAGG - Intronic
1139837480 16:69850912-69850934 CAAATGTACCACTCTGGTGGGGG - Intronic
1140709274 16:77661374-77661396 CAAATATACCATTCTAGTGTGGG - Intergenic
1141336489 16:83160229-83160251 CAAATGTACCACTCTGGTGGGGG + Intronic
1143143801 17:4759930-4759952 CAAATCTATCACTCTGGTGCCGG - Intergenic
1143690055 17:8554354-8554376 TAAATCTACCATTATAGTGCTGG - Intronic
1146168147 17:30608193-30608215 CACATCTGCCACTCTCAAGCTGG - Intergenic
1146221115 17:31021674-31021696 CACATCTGCCACTCTCAAGCTGG - Intergenic
1146281349 17:31546802-31546824 CAGATGTACCACTCTAGTGGAGG - Intergenic
1148034468 17:44648465-44648487 CATATGTACCATTCTAGTGCAGG + Intergenic
1148234511 17:45959234-45959256 CAAGTGTACCACTCTGGTGCAGG - Intronic
1148387791 17:47247394-47247416 CAAATGTACCACTCTGGTGGGGG + Intergenic
1148398532 17:47331528-47331550 CAAATGTACCACTCTGGTACAGG - Intronic
1150366682 17:64593771-64593793 CACATCTGCCACTCTCAAGCTGG + Intronic
1150543117 17:66124072-66124094 CACATGTACCACTCAAGGGGTGG + Intronic
1153169470 18:2299286-2299308 CAGATGTACCACTCTGGTGAGGG + Intergenic
1155630199 18:27884105-27884127 CAAATATACCACTCTAGTGTGGG + Intergenic
1155641438 18:28020853-28020875 CAAATATACCACACTAATGCAGG + Intronic
1155995360 18:32325413-32325435 CAAATATACCACTCTGGTGCAGG + Intronic
1155996892 18:32339928-32339950 CCCATCCACCACACTGGTGCTGG + Intronic
1156248555 18:35328227-35328249 CAAATATACCACTCTGGTGGGGG - Intergenic
1157037756 18:43996628-43996650 CAAATGTTCCACTCTAATGCAGG + Intergenic
1157341828 18:46785509-46785531 CAAATCTACCACTCAGGTGTGGG - Intergenic
1158937333 18:62376560-62376582 CAAATGTACCACTCTAGTGGGGG - Intronic
1159608283 18:70498011-70498033 CACATGTACCACTCTGCTGGTGG - Intergenic
1159907788 18:74113471-74113493 AACATTGTCCACTCTAGTGCAGG + Intronic
1162234891 19:9300986-9301008 CAAATTTACCACTCTGGTGGGGG + Intronic
1163163872 19:15482009-15482031 CAGATATACCATTCTGGTGCTGG - Intronic
1164765430 19:30762129-30762151 CAAATGTACCACACCAGTGCAGG - Intergenic
1165547867 19:36556768-36556790 CAGAGCCACCATTCTAGTGCTGG - Intronic
1165877169 19:39016319-39016341 AACATGTACCACTCTGGTGGGGG + Intronic
1167289725 19:48617717-48617739 CAGATCCTCCATTCTAGTGCTGG - Intronic
1167356344 19:49006582-49006604 CAGATCCACCACTTAAGTGCAGG - Intronic
925562984 2:5218285-5218307 CAAATGTACCACTCCAGTGCAGG - Intergenic
926947663 2:18205761-18205783 GACATGTACCACTATGGTGCAGG - Intronic
927662448 2:25004341-25004363 CATATCTCCCACCCTATTGCTGG - Intergenic
928366803 2:30709167-30709189 CACATGTGCCACTCTGGTGTGGG - Intergenic
930241764 2:48942849-48942871 CACATGTGCCACTCTGGTGGGGG - Intergenic
931900790 2:66785656-66785678 CAAATGTACCACTCTGGTGGTGG + Intergenic
931965495 2:67529197-67529219 AACATGTACCACTGTGGTGCAGG + Intergenic
933133735 2:78704742-78704764 CACATCTTCCACTCAAGAGATGG + Intergenic
933213430 2:79597733-79597755 CAAATATACCACTATAGTACTGG - Intronic
933853130 2:86386769-86386791 CAAATGTACCACTCTGGGGCAGG - Intergenic
933864561 2:86504292-86504314 CAAATGTACCACTCTGGTGTGGG + Exonic
933865562 2:86513542-86513564 CAAATGTACCACTCTTGTGTGGG + Intronic
934100634 2:88649951-88649973 CAAATATACCACTCTGGTGTGGG - Intergenic
935024345 2:99261967-99261989 CACATTTACCCCTCTAAAGCAGG + Intronic
936085438 2:109464766-109464788 CACATGTACCACTTTGGTGTAGG - Intronic
936238238 2:110764689-110764711 CAAATATACCACTCTGGTGGGGG + Intronic
936565111 2:113576917-113576939 AACCTCTACCACCCAAGTGCTGG - Intergenic
936919408 2:117672193-117672215 CAAATGTACCACTCTGGTGGGGG + Intergenic
937598069 2:123694225-123694247 CAATTGTACCACTCTAGTGGGGG + Intergenic
938830301 2:135043557-135043579 CAAATGTACTACTCTGGTGCAGG - Intronic
939664375 2:144932671-144932693 CAAATGTACCACTCTGGTGGGGG - Intergenic
939857845 2:147382014-147382036 CAAATGTACCACTCTGGTGTGGG + Intergenic
940425012 2:153521491-153521513 AACATGTACCACTCTGGTACGGG - Intergenic
941212381 2:162657104-162657126 CAAATGTACCAATCTGGTGCAGG - Intronic
941339173 2:164284842-164284864 CAAATGTACCACTTTGGTGCAGG + Intergenic
942287025 2:174429575-174429597 CAAATGTACCATTCTGGTGCTGG - Exonic
943287915 2:186028275-186028297 CAAATGTACCACTCTGGCGCAGG + Intergenic
943329014 2:186536686-186536708 CATATGTACCACTCTGGTGCAGG - Intergenic
944461268 2:199953375-199953397 CAAATATACCACTCTAATGAGGG + Intronic
944486933 2:200216681-200216703 CATAACCACCACCCTAGTGCAGG - Intergenic
945357351 2:208856350-208856372 CTCCTCTCCCACTCGAGTGCTGG + Intergenic
1168867369 20:1099173-1099195 CAAATGTACCACTCTGGTGTGGG + Intergenic
1168902720 20:1378574-1378596 CACACGTACCATTCTAGTGGGGG + Intronic
1169833957 20:9856804-9856826 CAAATGTACCACTCTGGTGAGGG + Intergenic
1170417036 20:16155656-16155678 CAAATGTACCACTCTAGTGGAGG + Intergenic
1170611629 20:17918487-17918509 CAAATCTACCACCCTGGTACGGG + Intergenic
1170689175 20:18596863-18596885 CAAATGCACCACTCTAGTGGTGG - Intronic
1170867531 20:20172736-20172758 CAAATGTTCCAATCTAGTGCTGG - Intronic
1171384518 20:24761137-24761159 CAAATGTATCACTCTAGTGTGGG + Intergenic
1172553796 20:35822933-35822955 TAAATGTACCACTCTGGTGCAGG - Intronic
1173303977 20:41830489-41830511 CACTTCTCCCAATCTACTGCAGG - Intergenic
1174010910 20:47448938-47448960 CAAATATACCACTCTGGTGCAGG + Intergenic
1175011659 20:55744106-55744128 CACGTGTGCCACTCTGGTGCGGG + Intergenic
1177484458 21:21738919-21738941 CAAATATACCACTCTAGTGGGGG + Intergenic
1177766083 21:25459085-25459107 CAAATGTACCATTCTGGTGCAGG + Intergenic
1178861054 21:36290090-36290112 CAAATGTACCACTCTGGTGCAGG + Intronic
1181678704 22:24475748-24475770 CAAATGCACCACTCTGGTGCTGG - Intergenic
1182289411 22:29266810-29266832 CACATCTACCAGTTTCCTGCAGG + Intronic
949428848 3:3950492-3950514 CAAATGTACCACTCTGGTACAGG + Intronic
951829685 3:26912231-26912253 CAAATGTACCACTGTGGTGCAGG + Intergenic
952566351 3:34663245-34663267 AAAATGTACCACTCTGGTGCAGG - Intergenic
952917277 3:38256483-38256505 CAAATGTACTACTCTAGTGGGGG - Intergenic
953192661 3:40702109-40702131 CAAATGTACCACTGTGGTGCAGG - Intergenic
953779817 3:45857831-45857853 CACATGTACCATTCTGGTGGGGG - Intronic
955479350 3:59373798-59373820 CAAATGTACCACTCTGGTGGGGG + Intergenic
955677966 3:61469225-61469247 CAAATGTACCACTCTAGTGCAGG - Intergenic
955677980 3:61469350-61469372 TAGATGTACCACTCTGGTGCAGG - Intergenic
957901762 3:86503353-86503375 TACATGTACCACTCTAATGGAGG - Intergenic
959112388 3:102137245-102137267 CATATGTACCACTCTGGTGTGGG - Intronic
960588011 3:119338402-119338424 CACATCTACCAATTAAATGCAGG - Intronic
960904555 3:122586751-122586773 CAAATGTACCACTCTGGCGCTGG - Intronic
963015183 3:140817217-140817239 CAAATATACCACTCTGGTGGGGG + Intergenic
963587962 3:147217472-147217494 CAAATATACCACTCTGGTGTGGG + Intergenic
963824943 3:149943350-149943372 CAGATGGACCACTCTAGTGCAGG - Intronic
963824956 3:149943475-149943497 CAGATGTACCACTCTGGTGCAGG - Intronic
965029494 3:163346497-163346519 CAAATGTACCACTCTGGTGTAGG + Intergenic
965641524 3:170833760-170833782 CAAATGTACCACTCTGGTGGGGG - Intronic
965848827 3:172996603-172996625 CAAATATACCACTCTGGTGAGGG - Intronic
966399367 3:179532682-179532704 CAAATATACCACTCTGGTGTGGG - Intergenic
967110910 3:186293074-186293096 CAAATGTACCACTCTGGTGGGGG - Intronic
967806542 3:193719265-193719287 CACATGTACCACACTGGTGAGGG + Intergenic
968227351 3:196981873-196981895 CAAATGTACCACTCTGGTGCAGG + Intergenic
968288479 3:197521785-197521807 AACACCTACCACCCTAGTTCCGG + Intronic
969337484 4:6520206-6520228 CACATCTCCCACCCTGGGGCAGG - Intronic
970968726 4:21957041-21957063 CAAATCTACCACTAGAATGCTGG - Intergenic
971639701 4:29116656-29116678 CAAATTTACCACTCTGGTGGGGG - Intergenic
972807263 4:42542067-42542089 CAAATGTACCACTCTGGTGGGGG + Intronic
972911915 4:43827674-43827696 CAAATATACCATTCTAGTGTAGG + Intergenic
973134885 4:46695068-46695090 CAAATATACCACTCTGCTGCAGG - Intergenic
974843565 4:67324448-67324470 CAAATATACCACTCTGGTGAGGG + Intergenic
975389888 4:73803302-73803324 CTCCTCTTCCACTCAAGTGCTGG - Intergenic
976064154 4:81164620-81164642 CACACCTAACACTCTAATGGTGG - Intronic
976133406 4:81908994-81909016 CAAATGTACCACTCTGGTGCAGG + Intronic
976172646 4:82319937-82319959 CAAATGTACCATTCTAGTGCAGG + Intergenic
976818701 4:89180254-89180276 CAAATGTACCACTCTGGTGTGGG - Intergenic
977763358 4:100767130-100767152 CAAATGTACCACTCTGGTGAAGG + Intronic
977822196 4:101486068-101486090 CAAATGTACCACTGTGGTGCAGG - Intronic
977940859 4:102857091-102857113 CAAATGTACCACACTAATGCAGG + Intronic
978893771 4:113860369-113860391 CATATGTACCACTCTGGTGCTGG - Intergenic
979706674 4:123727884-123727906 CAAATGTACCACTCTGGTGCAGG - Intergenic
979830373 4:125293209-125293231 CAAATTTACCACTCTGGTGGAGG + Intergenic
979991243 4:127378337-127378359 CAAATGTACCACTCTGGTGGGGG - Intergenic
980061127 4:128131186-128131208 CTAATGTATCACTCTAGTGCAGG + Intronic
980327204 4:131362173-131362195 CAAATCTACCACACTGATGCAGG + Intergenic
980391074 4:132147408-132147430 CAAATCTACCACTCAAGTGCAGG + Intergenic
980595605 4:134950453-134950475 CTAATTTACCACTCTAGTGCAGG + Intergenic
980600029 4:135010943-135010965 CAAATGTACCACTCTGGTGGGGG - Intergenic
981486397 4:145291121-145291143 CAAATGTACCACTCTGGTGTGGG - Intergenic
983110709 4:163745966-163745988 CAAATGTACCACTCTGGTGGGGG - Intronic
984027723 4:174564554-174564576 CAAATGTATCACTCTAGTGTAGG - Intergenic
984100126 4:175474313-175474335 CAAATGTACCACTCTGGTGGGGG + Intergenic
984114640 4:175664380-175664402 CAAATGTACCACTCTGGTGAGGG + Intronic
984404587 4:179311537-179311559 CAAATGTACCACTGTGGTGCGGG - Intergenic
985308093 4:188565759-188565781 CACATTTACCACTCTTGTGGGGG - Intergenic
986236183 5:5912964-5912986 CATAGCTTCCACTCTAGTGACGG + Intergenic
986942156 5:12966893-12966915 CACATGCACCATTCTAGTGAGGG - Intergenic
987934697 5:24449188-24449210 CAAATGTACCACTCTGGTGTGGG - Intergenic
988304745 5:29480376-29480398 CACCTATACCACTCCAGAGCAGG - Intergenic
989277342 5:39604693-39604715 CAAATCTACCACTCTGGTGCAGG - Intergenic
989711865 5:44407945-44407967 CAAATGTACTACTCTGGTGCAGG + Intergenic
990173601 5:53082622-53082644 CAAATATACCACTCTTGTGCGGG - Intronic
992495009 5:77283291-77283313 CAAATGTACCACTCTGGTGGGGG - Intronic
994611031 5:102039755-102039777 CAAGTATACCACTCTAGTGCAGG - Intergenic
995205468 5:109474997-109475019 CACATGTAGCAATATAGTGCTGG + Intergenic
995253543 5:110019852-110019874 CTCCTCTCCCACTCTAGTGCTGG - Intergenic
995466488 5:112454565-112454587 CAAATGTACCACTCTGGTGGGGG - Intergenic
996752166 5:126899870-126899892 CACATGTACCACTGTGGTGTGGG - Intronic
997247504 5:132362948-132362970 CACAGTTACCACTCTAGTTCAGG + Intergenic
998361883 5:141595358-141595380 CAAATGTACCACGCTAGTGGGGG + Intronic
999373570 5:151070973-151070995 AAAATCTACCACTCTGGTGGAGG + Intronic
999845439 5:155474464-155474486 CAAATCTACCACTCTTTTGGGGG - Intergenic
1000002554 5:157152724-157152746 CAAATGAACCACTCTGGTGCAGG - Intronic
1000597363 5:163231208-163231230 CAAATTAACCACTCTGGTGCTGG - Intergenic
1001373719 5:171233928-171233950 CAAATGCACCACTCTAGTGGGGG + Intronic
1001466217 5:171968773-171968795 AACATCTAAGACACTAGTGCTGG + Intronic
1001658246 5:173370693-173370715 CCCATCTCCCACTCTAGTGGTGG + Intergenic
1002386883 5:178875144-178875166 CTCCTCTCCCACTCGAGTGCTGG + Intronic
1005480684 6:26252414-26252436 CACGTCCACCAGTCTAGAGCTGG + Intergenic
1005523046 6:26617003-26617025 CAAATGTACCACTCTGGTACAGG + Intergenic
1005728811 6:28675866-28675888 CAAATGTACCACTTTGGTGCAGG + Intergenic
1006421575 6:33937466-33937488 CACATGTACCACTCTGGTGCAGG - Intergenic
1006642301 6:35495726-35495748 CACATGTTCCACCCCAGTGCTGG - Intronic
1006992629 6:38228451-38228473 CAAATGTACCACTCTGGTGGAGG + Intronic
1007018478 6:38494474-38494496 CATTACTACTACTCTAGTGCTGG - Intronic
1007365006 6:41385073-41385095 CAAATGTGCCACTCCAGTGCAGG - Intergenic
1010828676 6:80503960-80503982 CAAATATACCACTCTGGTGCAGG + Intergenic
1012090228 6:94883477-94883499 CAAATATACCACTCTAGTCTGGG - Intergenic
1012328246 6:97951157-97951179 CAAATGTACCATTCTAGTGTGGG - Intergenic
1012418311 6:99034060-99034082 CAAATGTACCACTCTGGTGGGGG + Intergenic
1013566607 6:111370818-111370840 CACATGTACCACTCTGGTAGGGG - Intronic
1014171511 6:118283967-118283989 CACTTCTACCACGCTAGAGGGGG + Intronic
1014324287 6:119972529-119972551 CATATGTACCACTCTGGTGGTGG + Intergenic
1015049475 6:128821884-128821906 CAAATGTACCATTCTAGTGAAGG + Intergenic
1016101401 6:140105644-140105666 CAAATGTACCACTCTGGTGGGGG - Intergenic
1016125583 6:140398825-140398847 CACATGTCCCACTCTGGTGGGGG - Intergenic
1016222644 6:141693783-141693805 CAAATGTACCACTCTGGTGGGGG + Intergenic
1016430300 6:143977124-143977146 CAAATGTACCACTCTAGTGGGGG - Intronic
1017189035 6:151631900-151631922 CAAATGTGCCACTCTGGTGCAGG - Intergenic
1017239150 6:152147761-152147783 CAGAGCTTCCACTCTAGTGTGGG - Intronic
1017445239 6:154501789-154501811 CACATCTACCACACTAAAGCCGG + Intronic
1017978237 6:159376181-159376203 CACATCTTCCTCCCTAATGCCGG - Intergenic
1019402834 7:866397-866419 CACAGCTGCCACTCTCGTGACGG - Intronic
1020513852 7:9091360-9091382 CTCCTCTCCCACTCAAGTGCTGG - Intergenic
1021087890 7:16445185-16445207 CAAATGTACCACTTTGGTGCAGG + Intergenic
1021314323 7:19127617-19127639 CACTACTACCACTCAAGTTCAGG - Intergenic
1021664056 7:22956643-22956665 CAAACGTACCACTCTGGTGCGGG + Intronic
1022480059 7:30737179-30737201 CAAATGTACCACTCTGGTGGGGG - Intronic
1022658237 7:32341042-32341064 CACATGTACCACTCCAGTGGGGG + Intergenic
1022689097 7:32628402-32628424 CAAATGTACCACTCTGGTGCGGG + Intergenic
1022916675 7:34962803-34962825 CAAATGTACCACTCTGGTGCGGG + Intronic
1026184224 7:68069493-68069515 CTGATGTACCACTCTGGTGCAGG + Intergenic
1027719330 7:81719355-81719377 TAGATCTCCCACTCTAGTGTGGG - Intronic
1028194652 7:87892045-87892067 CAAATGTACCACTCTGGTGTGGG - Intronic
1028586175 7:92454064-92454086 CAAGTGTACCACTCTAGTGGTGG + Intronic
1028599587 7:92587855-92587877 CAAATGTACCACTCTGGTGAAGG + Intronic
1028770182 7:94610399-94610421 CAAATATACCACTCTGGTGGGGG + Intronic
1029839519 7:103347436-103347458 CACATCTACAAATATAGTGAAGG - Intronic
1030290524 7:107867657-107867679 AACATGTACCACTCTTGTGGGGG + Intergenic
1030723945 7:112902672-112902694 CAAATGTACCACTCTAGTGCTGG + Intronic
1031225329 7:119029847-119029869 CTAATGTACCACTCTAGTGGGGG + Intergenic
1031639973 7:124150596-124150618 CAAATTTACCACTCTAGTGGGGG - Intergenic
1031668238 7:124512071-124512093 CGAATGTACCACTCTAGTGTGGG + Intergenic
1032142659 7:129347329-129347351 CAGATGTACCACTCTGGTGCAGG + Intronic
1032178452 7:129653398-129653420 CAAATGTACCACTCTGGTGCAGG - Intronic
1034499759 7:151441987-151442009 CAAATGTACCACTCTAATGGGGG - Intergenic
1034609209 7:152349827-152349849 CAAATGTACCACTCTAGTATAGG + Intronic
1036615235 8:10382552-10382574 CACCTTTACAACTCTAGTTCAGG - Intronic
1036667662 8:10758097-10758119 CAAATGTACCACTCTGGTGGGGG - Intronic
1036774812 8:11603777-11603799 CACATCAGCCACACTAGGGCAGG - Intergenic
1037475875 8:19257240-19257262 CATAACGACCACTCTTGTGCTGG + Intergenic
1039163109 8:34644722-34644744 CAGATATACCACTCTGGTGGGGG - Intergenic
1039510063 8:38084671-38084693 CACATTTACTCATCTAGTGCTGG + Intergenic
1039734972 8:40322025-40322047 CACATATACTACTCTAGAGCAGG - Intergenic
1040406210 8:47105732-47105754 CAACTGTACCACTCTAGTGAGGG + Intergenic
1042208877 8:66357566-66357588 CAAATATACCACTCTAGTGTGGG - Intergenic
1042253762 8:66782431-66782453 CATATGTACCACTCTGGTGGGGG - Intronic
1042810691 8:72822531-72822553 CACCTCCACCACCCTAGTCCAGG + Intronic
1043649926 8:82578674-82578696 CACAGCTGCCACTCTATTGGAGG - Intergenic
1045037614 8:98188158-98188180 CAAATGTACCACTCTGGTGGGGG + Intergenic
1046227457 8:111302716-111302738 CAAATGTACCACTCTGGTGGAGG + Intergenic
1048994211 8:139781664-139781686 CAAATGTACCACTCTAGTGTGGG + Intronic
1050859237 9:10404031-10404053 CAAATCCACCACTCTGGTGGAGG + Intronic
1051797817 9:20893819-20893841 CAAATATACCACTCTGGTGGGGG - Intronic
1052166574 9:25337773-25337795 CAAATGTACCACTTTGGTGCGGG + Intergenic
1052582542 9:30377482-30377504 CAAATTTACCACTCTGGTGGAGG + Intergenic
1052783872 9:32810817-32810839 CAAATGTACCACTCTGGTGGGGG + Intergenic
1052892756 9:33719531-33719553 CACACCTAACGCTCTACTGCTGG - Intergenic
1053187876 9:36034445-36034467 CAAATGTACCATTCTGGTGCAGG + Intergenic
1055538632 9:77277380-77277402 CAAATGTACCACTCTAGTGGAGG - Intronic
1055781507 9:79826259-79826281 CACATGTACTACTCTGGTGGAGG + Intergenic
1055972252 9:81923269-81923291 CAAATGTACCACTCTAGTATGGG + Intergenic
1055974005 9:81938341-81938363 CAAATGTACCACTCTAGTATGGG + Intergenic
1055997465 9:82175760-82175782 CAAATGTACCACTCAGGTGCTGG - Intergenic
1056594082 9:87991080-87991102 TAAATCTCCCACTCCAGTGCAGG - Intergenic
1057462453 9:95275535-95275557 CAAATGTACCACTCTGGTGGGGG + Intronic
1058772720 9:108252619-108252641 CAAATGTACCACTCTGGTGAGGG + Intergenic
1059892716 9:118821929-118821951 CAAATGTACCACTCTGGTACAGG - Intergenic
1060169403 9:121448766-121448788 CAAATGTATCACTCTGGTGCAGG - Intergenic
1060769058 9:126317687-126317709 CAAATGTACCACTCTGGTGGTGG + Intergenic
1061581810 9:131542180-131542202 CAAATGTACCACTCTGGTGTGGG - Intergenic
1061750364 9:132772869-132772891 CACAGCTACCACCCTGGTCCAGG + Intronic
1186533391 X:10320464-10320486 CAAATGTTCCACTCTAGTGGGGG - Intergenic
1186699542 X:12075298-12075320 CAAATGTACCACTCTGGTGAAGG + Intergenic
1188622170 X:32239475-32239497 CAAATGTACCACTCTGGTGTGGG - Intronic
1188859603 X:35241886-35241908 CAAATGTACCACTCTGGTGTGGG - Intergenic
1189158617 X:38786790-38786812 CAAATGCACCACTCTGGTGCAGG + Intergenic
1189158620 X:38786826-38786848 CAAATGCACCACTCTGGTGCAGG + Intergenic
1189201310 X:39197919-39197941 CATATCTACAACTTGAGTGCTGG + Intergenic
1189411662 X:40778247-40778269 CAAATATACCACTCTGGTGGGGG - Intergenic
1189464963 X:41271619-41271641 CAAATATACCACTCTGGTGGGGG + Intergenic
1189727234 X:43979818-43979840 CAAATGTACCACTCTGGTGCAGG + Intergenic
1192419167 X:71013671-71013693 CAAATATACCACTCTGGTGTGGG + Intergenic
1192540418 X:71964948-71964970 CAAATGTACCACTCTGGTGCAGG + Intergenic
1193700442 X:84754067-84754089 CAAATGTAGCACTCTGGTGCAGG - Intergenic
1194184438 X:90756491-90756513 CAAATGTACCACTCTGGTGGGGG + Intergenic
1194277511 X:91903846-91903868 CACCTCTACTACCCTAGTCCTGG - Intronic
1195587477 X:106581793-106581815 CAGATGTACCACTCTGGTGGAGG + Intergenic
1196496505 X:116329741-116329763 CATCTCTCCCACTCAAGTGCTGG - Intergenic
1198134724 X:133737398-133737420 CAAATGTACCACTCTGGTGAGGG + Intronic
1198199315 X:134399435-134399457 CAAATGTACCACTCTGGTGTAGG + Intronic
1198550169 X:137736843-137736865 CAAATGTACCACTGTAGTGGAGG - Intergenic
1199999478 X:153050627-153050649 CAAATGTACCACTCTGGTGCAGG + Intergenic
1200594855 Y:5125935-5125957 CACCTCTACTACCCTAGTCCTGG - Intronic