ID: 1069332434

View in Genome Browser
Species Human (GRCh38)
Location 10:67308609-67308631
Sequence TGGTATATGCATAATGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069332433_1069332434 -10 Left 1069332433 10:67308596-67308618 CCTAAATGTTAAGTGGTATATGC 0: 1
1: 0
2: 0
3: 16
4: 189
Right 1069332434 10:67308609-67308631 TGGTATATGCATAATGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069332434 Original CRISPR TGGTATATGCATAATGAGTA TGG Intronic
No off target data available for this crispr