ID: 1069334255

View in Genome Browser
Species Human (GRCh38)
Location 10:67329082-67329104
Sequence GGCAAATGGGCTGGGTGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069334248_1069334255 4 Left 1069334248 10:67329055-67329077 CCACTGATCTAATGTTTAATATA 0: 1
1: 0
2: 0
3: 25
4: 310
Right 1069334255 10:67329082-67329104 GGCAAATGGGCTGGGTGCAAGGG No data
1069334247_1069334255 5 Left 1069334247 10:67329054-67329076 CCCACTGATCTAATGTTTAATAT 0: 1
1: 0
2: 0
3: 20
4: 231
Right 1069334255 10:67329082-67329104 GGCAAATGGGCTGGGTGCAAGGG No data
1069334245_1069334255 10 Left 1069334245 10:67329049-67329071 CCTACCCCACTGATCTAATGTTT 0: 1
1: 0
2: 0
3: 11
4: 251
Right 1069334255 10:67329082-67329104 GGCAAATGGGCTGGGTGCAAGGG No data
1069334246_1069334255 6 Left 1069334246 10:67329053-67329075 CCCCACTGATCTAATGTTTAATA 0: 1
1: 0
2: 1
3: 32
4: 452
Right 1069334255 10:67329082-67329104 GGCAAATGGGCTGGGTGCAAGGG No data
1069334244_1069334255 18 Left 1069334244 10:67329041-67329063 CCATTGATCCTACCCCACTGATC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1069334255 10:67329082-67329104 GGCAAATGGGCTGGGTGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069334255 Original CRISPR GGCAAATGGGCTGGGTGCAA GGG Intronic
No off target data available for this crispr