ID: 1069336097

View in Genome Browser
Species Human (GRCh38)
Location 10:67352612-67352634
Sequence CTGCTAACATACAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069336097 Original CRISPR CTGCTAACATACAGGAAAAA TGG (reversed) Intronic
902534485 1:17111651-17111673 CTACTAAAATACAGGTAAATGGG + Intronic
904764941 1:32838395-32838417 CTGCTAATAGAAATGAAAAACGG - Intronic
905007840 1:34725399-34725421 CTGCTATCATACAGTAGGAATGG - Intronic
908491205 1:64645916-64645938 CTGGTAGCATACAAGAAAAGAGG + Intronic
909219649 1:72939948-72939970 CTGTTAAAATACTGGAAAATAGG + Intergenic
910945766 1:92589983-92590005 CTGCTGATATACAGGCAAACAGG + Intronic
911273301 1:95829812-95829834 CTGCTGACACACAGGAGGAAAGG + Intergenic
912989935 1:114475367-114475389 CTGCTAAAAAACAGTAATAAAGG + Intronic
913078083 1:115358347-115358369 CTGCTACCACAATGGAAAAAAGG - Intergenic
916102970 1:161408677-161408699 CTGTTAAACTCCAGGAAAAAGGG - Intergenic
916896802 1:169171918-169171940 CTAATAACACTCAGGAAAAATGG - Intronic
916951789 1:169787901-169787923 CTGATAAGATATAGGAAAATGGG - Intronic
917804882 1:178604630-178604652 CTGCTCGCATACAGGCCAAACGG + Intergenic
918062439 1:181073695-181073717 CTGCTAACACGCTAGAAAAAGGG - Intergenic
918102004 1:181384473-181384495 CTGCTACCCTACATGGAAAAAGG - Intergenic
918598113 1:186317372-186317394 ATTTTAAAATACAGGAAAAAAGG + Intronic
920632123 1:207662920-207662942 CTGCTGACATCCAGGCAAACAGG - Intronic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
922247864 1:223818038-223818060 CTGTTTACATAAAGGAAAAATGG + Intronic
923918759 1:238540612-238540634 CTGCTAACACCCAGGAGAAAAGG - Intergenic
1063001653 10:1929899-1929921 CTGCTAGAATGAAGGAAAAATGG + Intergenic
1063073199 10:2688186-2688208 CTGAAAACTGACAGGAAAAAGGG - Intergenic
1063108342 10:3013246-3013268 CTGCTAACAAGAAGGAGAAAAGG - Intergenic
1063435878 10:6029637-6029659 CTGCTAATTTAAAGAAAAAATGG + Intronic
1064352681 10:14591015-14591037 CTGCAAACATACGGAAGAAATGG - Intronic
1064567687 10:16659010-16659032 TTGCTAATATACATGAAAAATGG - Intronic
1065157646 10:22886505-22886527 CTGCTGATACACAGGAAAACAGG + Intergenic
1065303316 10:24345194-24345216 CTCCTAACACACACAAAAAAGGG + Intronic
1065399798 10:25286128-25286150 ATACTAAAATACAAGAAAAAGGG - Intronic
1067027424 10:42856704-42856726 CTCCTAACAAAAAGGAAATAAGG - Intergenic
1067912372 10:50359132-50359154 TTGCTAAGATACAAGAAGAAGGG + Intronic
1068118825 10:52763698-52763720 CTGATAACATACAAGTACAAAGG - Intergenic
1068173868 10:53430917-53430939 CTGGAAACAAACAGGCAAAATGG - Intergenic
1068175210 10:53448195-53448217 CTGCTAACATCCAAGACAATGGG - Intergenic
1069336097 10:67352612-67352634 CTGCTAACATACAGGAAAAATGG - Intronic
1071781565 10:88851917-88851939 GTGGTAACATGCAGGAAAGAAGG + Intergenic
1072025402 10:91450748-91450770 CAGCCAACAAACATGAAAAAAGG + Intronic
1073269697 10:102252036-102252058 CTGCTAAAAAAGTGGAAAAAAGG + Intronic
1073434988 10:103510913-103510935 CTGGAAACATCCAGGAAATAAGG - Intronic
1073640408 10:105246962-105246984 CAGATAATATACAGGAAGAAAGG + Intronic
1074036072 10:109739985-109740007 CTGCTCATACACAGGAAAACTGG + Intergenic
1074303268 10:112251766-112251788 CTGCTGACACCCAGGCAAAAAGG + Intergenic
1074573876 10:114650165-114650187 CTGCTAACAGAAAGGGAATATGG - Intronic
1075708984 10:124520600-124520622 TTGTTAACATGCAGGACAAAGGG + Intronic
1076245905 10:128947545-128947567 CTTTTAACATATGGGAAAAATGG + Intergenic
1076765718 10:132631860-132631882 CTCCTACCTTAAAGGAAAAAAGG - Intronic
1078294006 11:10046964-10046986 CTTCTGACATAAAGGAAAAGTGG - Intronic
1078355895 11:10631083-10631105 AAGCTAACACACAAGAAAAAAGG + Intronic
1078433696 11:11307507-11307529 TTGCTATCAAACAGGAAAACTGG + Intronic
1079570223 11:21933937-21933959 ATGCTAAAAGAAAGGAAAAAAGG - Intergenic
1079988893 11:27226540-27226562 CTGCTGACATACAGGAGACTGGG + Intergenic
1080088720 11:28317848-28317870 CTGATATCATACATGAAACAGGG + Intronic
1080192165 11:29563938-29563960 CTGCATAAATACAGAAAAAAAGG - Intergenic
1080410761 11:32022853-32022875 CAGGTAACATTCAAGAAAAAAGG + Intronic
1081161569 11:39755894-39755916 CTGCTGACACCCAGGCAAAAAGG + Intergenic
1081500130 11:43658666-43658688 CTGCTGACACCCAGGAAAACAGG - Intronic
1082935054 11:58647436-58647458 CTGCTTACATGCAGCCAAAAAGG + Intronic
1083121536 11:60517806-60517828 CTGTTAACTTACAGGAGAATTGG + Intronic
1083536820 11:63477231-63477253 CTGCAAAGAAACAGGAAAGAGGG - Intronic
1084391563 11:68880649-68880671 CTGCTAACCTCCAGGAAGGAGGG - Intergenic
1086368061 11:86128628-86128650 CTTCTAACAAACAGGCAAATTGG - Intergenic
1086884660 11:92191190-92191212 CTAGTAAGATACAGGAAATAAGG + Intergenic
1087539033 11:99491348-99491370 TTGCTAACATACTGTCAAAACGG + Intronic
1087764560 11:102136278-102136300 CAGTTATCATACAGGAAAAAGGG - Intronic
1087849285 11:103009762-103009784 GTGCTAATATACAAGAAAACAGG - Intergenic
1088035517 11:105308837-105308859 CTTCTAAAATATACGAAAAATGG + Intergenic
1088851645 11:113708005-113708027 GTGCTTACAGACTGGAAAAAGGG + Intergenic
1091186503 11:133652362-133652384 CTACTAAAATCCAGGGAAAATGG - Intergenic
1091900703 12:4141850-4141872 CTGGGAACACACAGGATAAAGGG - Intergenic
1092802020 12:12177951-12177973 CTGGTACCATACAGGGAAGAAGG + Intronic
1094068815 12:26390149-26390171 CTGCTAACAGAAATGTAAAATGG + Intronic
1097551143 12:61071530-61071552 CTCCTAACACACAGGAATATGGG - Intergenic
1099070086 12:78035311-78035333 CTGCTCACAAACAGAAAAATAGG - Intronic
1099791128 12:87335273-87335295 TTCCTAAAATTCAGGAAAAATGG + Intergenic
1100593301 12:96049708-96049730 TTGCAAACATACTGGGAAAATGG + Intergenic
1101495165 12:105246671-105246693 CTGCTGACACCCAGGCAAAAAGG + Intronic
1102326002 12:111984611-111984633 CTTATAACACAAAGGAAAAAGGG + Intronic
1103277296 12:119723138-119723160 CCCCTAAAATACAGGAAAAAAGG + Intronic
1104168494 12:126257099-126257121 ATGCTAAGATAAAGGAAAAGAGG - Intergenic
1104544386 12:129698500-129698522 CTTTAAACATAAAGGAAAAAAGG + Intronic
1104626894 12:130364262-130364284 ATGCTAAAATACAAGAATAATGG - Intronic
1105493376 13:20908494-20908516 CTGCTGACATACTGGTACAAAGG + Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1106813917 13:33386680-33386702 CTGGAAACATAAAGGCAAAAAGG - Intergenic
1107252265 13:38378500-38378522 CTATTAACATAGAGGAAAATGGG + Intergenic
1107528912 13:41263105-41263127 TTGCTAACAGACAGAATAAAAGG + Intronic
1107852581 13:44586137-44586159 TTGCTAACATACATTCAAAATGG + Intergenic
1108080523 13:46730135-46730157 CTCCTAACAAACAGCAAAAAGGG - Intronic
1108763223 13:53595356-53595378 CTGCAAACATATTAGAAAAATGG + Intergenic
1109210437 13:59529114-59529136 CTGCTAAAATACCAGAAAAGGGG + Intergenic
1110485769 13:76039784-76039806 CTTATTACATACAGGATAAATGG + Intergenic
1111179699 13:84647404-84647426 CTTCTAACATTTAGGAGAAAAGG + Intergenic
1111995861 13:95165730-95165752 ATTCCAACATACAGGAAAAGTGG + Intronic
1112625022 13:101094063-101094085 CTGCACACTTACAGGAGAAAAGG - Intronic
1112835331 13:103507776-103507798 CTGCTGACACCCAGGCAAAAAGG - Intergenic
1113216020 13:108041630-108041652 CAGCCAACAAACATGAAAAAAGG - Intergenic
1114742785 14:25115332-25115354 CAGCCAACAAACATGAAAAAAGG + Intergenic
1116017943 14:39429896-39429918 TGGATAACATACAGGCAAAATGG - Intronic
1116353171 14:43892456-43892478 TGGCTAAAATAAAGGAAAAAAGG - Intergenic
1117403221 14:55376811-55376833 CTGCTAAGAGCAAGGAAAAAAGG + Intronic
1119081262 14:71696435-71696457 CTTCTAAAATGCAAGAAAAAGGG - Intronic
1122336867 14:100996404-100996426 CAGCCAACAAACAAGAAAAAAGG - Intergenic
1122879130 14:104682166-104682188 CTGCTATTCTACAGGAGAAAGGG + Intergenic
1123860681 15:24463152-24463174 CTACTAAAATACAAAAAAAATGG + Intergenic
1123925262 15:25102789-25102811 CAGCCAACAAACATGAAAAAAGG - Intergenic
1126431880 15:48594474-48594496 CTGCTCCCCTTCAGGAAAAAGGG - Intronic
1127168813 15:56276928-56276950 CAGCCAACAAACATGAAAAAAGG - Intronic
1127244285 15:57154493-57154515 TTTGTAACATAGAGGAAAAAGGG - Intronic
1129563711 15:76598179-76598201 CGGCCAACAAACATGAAAAAAGG + Intronic
1129621922 15:77155757-77155779 CTGCTGACACCCAGGCAAAAAGG - Intronic
1130019169 15:80212861-80212883 GTGCTACCCTTCAGGAAAAAAGG + Intergenic
1130729404 15:86474943-86474965 CTGCTAATACCCAGGCAAAAGGG + Intronic
1130778021 15:87005967-87005989 CTGCTAATATCCAGGCAAACAGG - Intronic
1132026559 15:98408725-98408747 ATACTAACATACAGGAAAGGTGG - Intergenic
1133492980 16:6289419-6289441 CTGCTAACATCCAAGTTAAAAGG - Intronic
1133658365 16:7889336-7889358 CTCCTAAGAGACAGGAATAAAGG + Intergenic
1134516307 16:14889899-14889921 CTGCTACTTTACAGGAAATAGGG + Intronic
1134703981 16:16288551-16288573 CTGCTACTTTACAGGAAATAGGG + Intronic
1134963562 16:18423563-18423585 CTGCTACTTTACAGGAAATAGGG - Intronic
1134967857 16:18506162-18506184 CTGCTACTTTACAGGAAATAGGG - Intronic
1136857215 16:33668271-33668293 CTCCTAACAAAAAGGAAATAAGG + Intergenic
1203118788 16_KI270728v1_random:1516762-1516784 CTCCTAACAAAAAGGAAATAAGG + Intergenic
1143902538 17:10184865-10184887 CTGCTGACCTCCAGGAAAAGGGG + Intronic
1144380650 17:14694301-14694323 CTACTAAGAAAAAGGAAAAAAGG + Intergenic
1146274538 17:31508433-31508455 CTGCTGACAGACAGGAGAGAAGG - Intronic
1147292068 17:39451466-39451488 CTGCTAAAATAAAAAAAAAATGG - Intergenic
1147641172 17:42000944-42000966 TTGCAAACTTACAGGAAAAATGG + Intronic
1148358978 17:46996199-46996221 TTCCTGACATACAGGAACAACGG + Intronic
1149261772 17:54887892-54887914 CTTCCACCATACAAGAAAAAAGG - Intergenic
1151855205 17:76716220-76716242 ATGATGACATACAGGAAGAAGGG + Exonic
1155549638 18:26951459-26951481 ATGCCAACACACAGGAAAAAAGG + Intronic
1156775483 18:40782783-40782805 CTGCTGACCTACAGTAACAATGG + Intergenic
1158075469 18:53523143-53523165 CAGCCAACAAACATGAAAAAAGG + Intronic
1160556037 18:79725894-79725916 CAGCTTACCTACAGGAAAAACGG - Intronic
1161141113 19:2648435-2648457 ATGCTAACATAAGGGAAAACTGG + Intronic
1162091332 19:8282029-8282051 GTGCTAGCTTACAGGAACAAAGG + Intronic
1162093566 19:8296882-8296904 GTGCTAGCTTACAGGAACAAAGG + Intronic
1162605005 19:11699884-11699906 CTGCTGAAACAGAGGAAAAAGGG - Intergenic
1164568445 19:29349203-29349225 CTGCTGATATCCAGGAAAACAGG + Intergenic
1165011095 19:32846904-32846926 CTGCTGACACCCAGGCAAAAAGG + Intronic
1165185486 19:34017191-34017213 CTGCTGTCATACAGGACAAATGG - Intergenic
1166237540 19:41467399-41467421 CTGCTAGTATCCAGGAAGAAAGG - Intergenic
1166245580 19:41523226-41523248 CTCCTAATATCCAGGAAGAAAGG - Intergenic
1166729606 19:45051610-45051632 CTGCTAACCTTCAGAAATAAGGG - Intronic
1168632747 19:57970197-57970219 CTTCTTATTTACAGGAAAAAAGG - Intronic
925119600 2:1407551-1407573 CTGCTAAGAGACAAGAAAAGGGG - Intronic
925781513 2:7386346-7386368 CTGATAACATACAGGATAGCAGG + Intergenic
925956235 2:8968247-8968269 CTGCTAATACCCAGGAAAACAGG + Intronic
926214728 2:10897869-10897891 CTCCTAACATCCAGGGAACAGGG - Intergenic
928804842 2:35138632-35138654 CTGCTAACATATTGGTAACAGGG - Intergenic
929532056 2:42759220-42759242 CTGCTGAGATGGAGGAAAAATGG - Intergenic
930074085 2:47392344-47392366 CTACTAAAATACAAAAAAAATGG - Intergenic
930319817 2:49840286-49840308 CTGAAAACAAGCAGGAAAAACGG + Intergenic
932003006 2:67901718-67901740 CTGCAAACTTACAGGGCAAAAGG + Intergenic
935395150 2:102599842-102599864 TTGCTAACTTACTTGAAAAATGG + Intergenic
936407936 2:112224660-112224682 CTGCTAATATACATAAAAACAGG + Intronic
937709829 2:124967466-124967488 CTGCTAATACACAAGAAGAAAGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
939553763 2:143648711-143648733 CTGCTACCATACTGGATACAAGG - Intronic
940847023 2:158652664-158652686 CTGCAAACATTCTTGAAAAATGG - Intronic
941161451 2:162039947-162039969 CTGGTATCAGAAAGGAAAAATGG + Intronic
941435928 2:165472073-165472095 CTGCAAACATAAAGAGAAAAAGG - Intronic
941521303 2:166547502-166547524 CTGTTAAAATATAGAAAAAATGG - Intergenic
941731432 2:168922260-168922282 CAGCTAACATACAAGAGACAGGG - Intergenic
942191641 2:173476477-173476499 CTGATAACTTTCAGCAAAAAAGG - Intergenic
942673724 2:178404684-178404706 CTGCTAACATACATGCTAACAGG + Intergenic
943274395 2:185848191-185848213 CAGCCAACAGACATGAAAAAAGG - Intergenic
943866741 2:192933971-192933993 CTGCCAAGATACAGAGAAAAGGG - Intergenic
947457717 2:230270806-230270828 CTGCTATCTTACATGACAAAAGG + Intronic
1170005296 20:11662127-11662149 TGGCTAACAATCAGGAAAAAAGG - Intergenic
1174279296 20:49427204-49427226 ATGCCAACACAAAGGAAAAAAGG + Intronic
1177194183 21:17885176-17885198 CAGGTAGCATACAGGAGAAATGG - Intergenic
1177211737 21:18080097-18080119 CAGCTAACAAACATGAAAAAGGG - Intronic
1177722624 21:24927839-24927861 GTGCTAATATCCAGGACAAAGGG + Intergenic
1180897343 22:19346447-19346469 CAGTAAACATACAGAAAAAAAGG + Intronic
1181336115 22:22130888-22130910 CAGCAAACATACAGGGAATAAGG - Intergenic
949880361 3:8656334-8656356 CTTCTAACATACAGGAAATGAGG + Intronic
953219750 3:40959144-40959166 CTGCTGACATCCAGGCAAACAGG - Intergenic
953250604 3:41243324-41243346 CTGCTCACATATGGGTAAAAAGG + Intronic
953868450 3:46605001-46605023 CTGCTAAGATACATGAAGAAGGG - Intronic
956009447 3:64815004-64815026 CAGCAAACAGACAAGAAAAAGGG + Intergenic
956920035 3:73918561-73918583 CTGCTATAAAACAGGAAATAAGG - Intergenic
957179112 3:76853462-76853484 ATGCTAACATAAAGGAACCACGG + Intronic
958495314 3:94836893-94836915 CTGCTGACACCCAGGAAAATAGG + Intergenic
958769317 3:98407445-98407467 CTGCTGACACCCAGGCAAAAAGG + Intergenic
958971150 3:100611348-100611370 TCGCTTACATAAAGGAAAAAAGG - Intronic
959182385 3:102998118-102998140 CAGCCAACAAACATGAAAAAAGG + Intergenic
959412776 3:106046159-106046181 CTTCTTACATTCAGGAAAGAAGG - Intergenic
959455192 3:106551044-106551066 ATGCAAACATACAGAAAATAAGG + Intergenic
959622326 3:108411766-108411788 CTGCTATTAAACAGAAAAAAAGG + Intronic
959688926 3:109177522-109177544 CTGGAGACATCCAGGAAAAAAGG + Intergenic
959963418 3:112327681-112327703 CTTCTCACATACAGGTAAATTGG + Intergenic
960409290 3:117302488-117302510 CTGCTAACGTACAAGATAAAAGG - Intergenic
962073280 3:132054108-132054130 CTGCTGACACCCAGGAAAACAGG - Intronic
962902165 3:139771040-139771062 CTGCAAAAAGTCAGGAAAAAGGG - Intergenic
964332259 3:155616659-155616681 CTGCTTGCCTACAGGAAAAGGGG + Intronic
964980641 3:162672854-162672876 CTGCTAGACTACAGAAAAAAGGG - Intergenic
965544531 3:169902107-169902129 TTTCTAATATAAAGGAAAAACGG + Intergenic
965849345 3:173004517-173004539 CTGTTAACATAGAGGATGAAGGG - Intronic
966821271 3:183926664-183926686 CTGGTAACATACTGGACAAAAGG + Intronic
967389926 3:188945664-188945686 CAGCTAACATACAGTAGAACTGG - Intergenic
969646982 4:8436481-8436503 CTGTTAAGATCTAGGAAAAAGGG + Intronic
971680663 4:29695535-29695557 CTCTTAACATACACAAAAAAAGG + Intergenic
971854233 4:32023424-32023446 CTGCTCACAAACAGAATAAAAGG - Intergenic
973020464 4:45199384-45199406 CTGCTAATACACAGAATAAAGGG - Intergenic
973035882 4:45405443-45405465 CTGTTAACATAAAATAAAAAAGG - Intergenic
973136223 4:46709855-46709877 CTGCCAACTTACAGGAACTAAGG - Intergenic
976498667 4:85760558-85760580 CTGCTTCCAAACAGGAAAAGTGG + Intronic
977936051 4:102805846-102805868 CTATTAATAAACAGGAAAAAAGG - Intronic
979193149 4:117888106-117888128 TTGGTAACATACAGGGAAAATGG + Intergenic
979697176 4:123625656-123625678 CTTCTCACTTACAGGAGAAATGG - Intergenic
982582210 4:157193431-157193453 CTGCTTACAGATAGGATAAATGG - Intergenic
982883710 4:160751145-160751167 CAGCCAACACACATGAAAAAAGG + Intergenic
984075910 4:175179455-175179477 CAGCCAACAAACATGAAAAACGG - Intergenic
984200977 4:176720912-176720934 ATGCTAAGATACAGCAACAATGG + Intronic
984506970 4:180632093-180632115 TTGCTAAAACACAGGAAAGATGG - Intergenic
985232257 4:187832205-187832227 CTGAAAACCTACAGGAGAAAAGG - Intergenic
985314107 4:188636422-188636444 TTGCTAAACCACAGGAAAAAGGG + Intergenic
986906402 5:12499029-12499051 CACCTAACATAAAGGATAAAAGG + Intergenic
988185517 5:27855796-27855818 CTGAGACCATACAAGAAAAAGGG + Intergenic
988815916 5:34834943-34834965 CTGCTAACAGCCAGGAGAAGAGG + Intergenic
988877723 5:35466625-35466647 ATGCTGAGATAGAGGAAAAATGG - Intergenic
989235091 5:39137983-39138005 ATGCGAACATACAGCAAGAATGG - Intronic
990584171 5:57193924-57193946 CTGCTAAGAAACAGGATTAAAGG - Intronic
990875298 5:60477521-60477543 CTGTTAAGATGGAGGAAAAAAGG + Intronic
991164883 5:63554138-63554160 ATGCTCACAAAGAGGAAAAATGG + Intergenic
993261732 5:85666269-85666291 ATGCTAAAATAAAGTAAAAAGGG + Intergenic
994022869 5:95048225-95048247 CTGCTACCATAAAATAAAAATGG + Intronic
994115950 5:96061485-96061507 CAGCTAACAGAGAAGAAAAAAGG + Intergenic
996158450 5:120132139-120132161 CTGCTGACACCCAGGCAAAAAGG - Intergenic
996279668 5:121713641-121713663 CTTCTAAGATACAGCAAAAGCGG + Intergenic
997130607 5:131272433-131272455 TTTTTAACATACAGGAAACAAGG - Intronic
997923969 5:138010677-138010699 CTGCTAGCATAGAGGAATATAGG - Intronic
998102467 5:139445635-139445657 CTGTTAATACACAGGAGAAATGG + Intergenic
998770621 5:145540566-145540588 CTACCAAGATACAGGAAATATGG + Intronic
999080713 5:148840902-148840924 ATGCTAACATTCAGGGAAACAGG + Intergenic
1002229647 5:177753106-177753128 CATTTAACATACAGGAAAACTGG + Intronic
1002265698 5:178030671-178030693 CATTTAACATACAGGAAAACTGG - Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1004122500 6:12838217-12838239 CTGCTCACACACAAGAGAAAAGG + Intronic
1004222385 6:13757994-13758016 ATGCTACCATACAGGGCAAAAGG + Intergenic
1004612529 6:17257175-17257197 CTGCTAAAATGTAGGAAGAAAGG - Intergenic
1005144817 6:22676995-22677017 CTGATTACATACAGGGATAAAGG + Intergenic
1005146310 6:22694113-22694135 TTCCTAACATACAGCAGAAAAGG - Intergenic
1005163085 6:22887846-22887868 TTGCAAAAACACAGGAAAAATGG + Intergenic
1005656133 6:27939547-27939569 CTGATAACATATGGGAAAAGTGG - Intergenic
1007567957 6:42867397-42867419 ATGTTACAATACAGGAAAAAGGG - Exonic
1007872538 6:45056920-45056942 CAGCCCACACACAGGAAAAAAGG + Intronic
1007910676 6:45511185-45511207 CTGCTTATATACAGAAAAAAAGG - Intronic
1008125053 6:47658725-47658747 CTGTTAACATTTAGGATAAATGG - Intronic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1009540352 6:64947533-64947555 CTGCTAAAATCCAGCAAAACTGG - Intronic
1011348793 6:86400110-86400132 GTGCTAACATCCAAGAAAACGGG - Intergenic
1011399277 6:86942140-86942162 CTGTTAGCATCCAAGAAAAATGG + Intronic
1012073181 6:94649305-94649327 CTCTTAACAGACAAGAAAAATGG + Intergenic
1013908965 6:115250941-115250963 CTGCTGACACCCAGGCAAAAAGG + Intergenic
1014756117 6:125303177-125303199 CTGCTGAGATACAGGAAATAAGG - Intergenic
1014960107 6:127672690-127672712 CTGCTGACACCCAGGAAAACAGG - Intergenic
1015799635 6:137047063-137047085 CAGCTAACAAACAAGAAAAGTGG - Intergenic
1016389975 6:143565217-143565239 CTGCTCAGATACAGAAAATAAGG + Intronic
1017109649 6:150920179-150920201 CTTCTAACAAACAGGATAAAAGG - Intronic
1018400885 6:163417858-163417880 GTACAAACATGCAGGAAAAAGGG + Intronic
1018772852 6:166987132-166987154 CTTCAAACTTAAAGGAAAAATGG - Intergenic
1020628681 7:10614607-10614629 CTATTGACATACAGGAAAGATGG - Intergenic
1020847674 7:13307484-13307506 CTTCTGAAATAAAGGAAAAAAGG + Intergenic
1021059587 7:16094478-16094500 CAGCAAACATACAAAAAAAATGG + Intronic
1021508326 7:21409389-21409411 CTACTAACATCCGGGATAAAGGG - Intergenic
1024138657 7:46438013-46438035 ATGCTAACATACAAGGAAAAAGG + Intergenic
1026076537 7:67175915-67175937 GTGCTAAAAGACAAGAAAAAGGG + Intronic
1026700328 7:72636423-72636445 GTGCTAAAAGACAAGAAAAAGGG - Intronic
1027563821 7:79766319-79766341 TTACTAATATACAGTAAAAATGG + Intergenic
1028503406 7:91544498-91544520 CTGCTTGCATACAGAATAAATGG + Intergenic
1028533688 7:91866921-91866943 CTGACAACCTACAGAAAAAATGG + Intronic
1028756691 7:94443120-94443142 ATGCTAAGATATAGGAAGAAGGG - Intergenic
1029821900 7:103154313-103154335 TTGCTAACAAACAAAAAAAAAGG + Intergenic
1030472710 7:109986833-109986855 CTGGTCACTTACAGGAAAAGAGG + Intergenic
1031048046 7:116915432-116915454 CTCCTAAGATAGAGTAAAAATGG - Intronic
1031168799 7:118264814-118264836 CTGCAAAAATAAAGGGAAAATGG + Intergenic
1031365662 7:120897667-120897689 CTGTTACCATACATGAATAAAGG - Intergenic
1031681943 7:124686300-124686322 ATGCTACCTTACATGAAAAAAGG + Intergenic
1034720208 7:153285344-153285366 CTGCTAACCCACAAGAACAATGG - Intergenic
1035340530 7:158157823-158157845 GTGCTGACACACAGGAAGAAAGG + Intronic
1035410852 7:158639619-158639641 CTACTAACATAGAAGAAACAGGG + Intronic
1035615887 8:1001145-1001167 CAGCAAGCATACAAGAAAAAGGG - Intergenic
1036293113 8:7512496-7512518 CTTTTAACATATAGGAACAAAGG - Intergenic
1036329446 8:7808504-7808526 CTTTTAACATATAGGAACAAAGG + Intergenic
1037373739 8:18206580-18206602 CGGCCAACACACATGAAAAAAGG - Intronic
1037412292 8:18611289-18611311 CTGCTAACATACTGTACAAAAGG - Intronic
1037613508 8:20496211-20496233 CTGAAAAATTACAGGAAAAATGG + Intergenic
1038014382 8:23501376-23501398 TTACCAACATACAGGGAAAAGGG + Intergenic
1038624341 8:29176265-29176287 CTGCTCACATGCAGGTACAAGGG - Intronic
1039105250 8:33982887-33982909 CTTCTAACATTTAGGGAAAAAGG - Intergenic
1041392799 8:57361749-57361771 CTGCCAATATGAAGGAAAAAAGG - Intergenic
1041657993 8:60373587-60373609 CAGTTAACATAAAGGAAAACAGG - Intergenic
1042892893 8:73633012-73633034 CTGCTTATACACAGGGAAAAAGG + Intronic
1043236116 8:77869251-77869273 CAGCCAACAAACATGAAAAAAGG + Intergenic
1044027349 8:87189944-87189966 TTGAAAACATGCAGGAAAAAGGG + Intronic
1044721392 8:95152519-95152541 CGGCTAATAAACAGGAAAAGAGG - Intronic
1049880604 8:145059750-145059772 CTCTTAACATCCAGGAAAACAGG + Intergenic
1050866989 9:10513497-10513519 TTGCAAGCATACAGGAAATAAGG + Intronic
1051204937 9:14677166-14677188 ATGTTTACATCCAGGAAAAATGG - Intronic
1051851308 9:21512102-21512124 CTGCTGTCAGACAGGAAAGATGG + Intergenic
1051925840 9:22323707-22323729 ATGCTAGCTTACAGGCAAAAGGG - Intergenic
1053319007 9:37079129-37079151 CTGTCAACCTAAAGGAAAAACGG - Intergenic
1055144248 9:72913645-72913667 CTGCATACATACTGGAGAAAAGG + Intronic
1057407606 9:94787828-94787850 CTTCTAAAAAGCAGGAAAAATGG - Intronic
1059056377 9:110985531-110985553 CTGATAAAATACATGTAAAAAGG - Intronic
1059935946 9:119310760-119310782 ATGCTAGCATACAGGAAGACAGG + Intronic
1060948554 9:127586001-127586023 CTACTAACATTTAGGAAAAGGGG + Intergenic
1062059854 9:134489356-134489378 CTGATACCATAGAGGACAAAAGG + Intergenic
1062151570 9:135021921-135021943 CTGACTTCATACAGGAAAAAAGG - Intergenic
1186011851 X:5143087-5143109 CTGATATCATGCAGTAAAAATGG - Intergenic
1187700821 X:21963019-21963041 CTGCAAAGATACAGTAATAAAGG + Intronic
1188629551 X:32336857-32336879 CTGCTAACATAGAGGCCTAAAGG - Intronic
1188963175 X:36518225-36518247 CTGCAAAGATACAGCACAAAAGG + Intergenic
1191750948 X:64542132-64542154 CTTCTAGAATACAGGAAAAGAGG + Intergenic
1191807995 X:65155884-65155906 CTTCTAGAATACAGGAAAAGTGG - Intergenic
1192007726 X:67234950-67234972 CTGCTGACACCCAGGAAAACAGG + Intergenic
1192884178 X:75319854-75319876 CTGGTGACACACAGGAAAACAGG - Intergenic
1193177788 X:78414833-78414855 CTGGGAAGAAACAGGAAAAAGGG + Intergenic
1198091217 X:133332243-133332265 CTGCTAAAAGACAGTAACAATGG + Intronic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1198654427 X:138898178-138898200 CTGCAAACAAGCAGGAGAAAGGG + Intronic
1200689614 Y:6294032-6294054 CTGCTGACACGCAGGAAAACAGG - Intergenic
1201045658 Y:9880688-9880710 CTGCTGACACGCAGGAAAACAGG + Intergenic
1201260502 Y:12154430-12154452 CTGGGACAATACAGGAAAAAAGG - Intergenic