ID: 1069340210

View in Genome Browser
Species Human (GRCh38)
Location 10:67401260-67401282
Sequence CAGTATATGCTGAAACTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1069340210_1069340215 17 Left 1069340210 10:67401260-67401282 CCACCCAGTTTCAGCATATACTG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1069340215 10:67401300-67401322 ATACTTTTAAAATATAGATTGGG No data
1069340210_1069340214 16 Left 1069340210 10:67401260-67401282 CCACCCAGTTTCAGCATATACTG 0: 1
1: 0
2: 0
3: 17
4: 147
Right 1069340214 10:67401299-67401321 CATACTTTTAAAATATAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1069340210 Original CRISPR CAGTATATGCTGAAACTGGG TGG (reversed) Intronic
901372978 1:8816848-8816870 CATTATTGGCTGAAACTGGAAGG - Intronic
903361109 1:22777819-22777841 CAGTATGTGCAGGCACTGGGTGG + Intronic
903518298 1:23927580-23927602 CAGGTTATGCTGATCCTGGGAGG + Intergenic
903997698 1:27318030-27318052 CAGTATATGCAGCATGTGGGAGG - Intergenic
905225547 1:36476511-36476533 CGGTATAAGCTGGAACTGAGAGG - Intronic
909685138 1:78339437-78339459 CAGTATTTGCTGAAAGTAGAAGG - Intronic
911410509 1:97499911-97499933 CAAAATATGATGAATCTGGGTGG + Intronic
913084240 1:115420852-115420874 GAGGATATGGAGAAACTGGGTGG - Intergenic
916021750 1:160798698-160798720 CAGAATATGCAGACACTGGAAGG - Intronic
916321200 1:163506317-163506339 CTGTGTATGTTGAAACTTGGAGG + Intergenic
917199004 1:172496098-172496120 CAGTAAAAGCAGAAACTGTGAGG - Intergenic
919291201 1:195633479-195633501 CAGTATATTTGGAAAGTGGGAGG - Intergenic
920540399 1:206773795-206773817 CAGTTTAGACTGTAACTGGGAGG + Intergenic
921647621 1:217636500-217636522 GAGAATCTGCTGAACCTGGGAGG - Intronic
921820824 1:219615060-219615082 CAGTAAATTTTGAAATTGGGTGG - Intergenic
1064621567 10:17222619-17222641 CAGTATAAGCAAAAACTGGGTGG - Intergenic
1069340210 10:67401260-67401282 CAGTATATGCTGAAACTGGGTGG - Intronic
1074915700 10:117952825-117952847 CAAATTCTGCTGAAACTGGGGGG - Intergenic
1075214505 10:120520339-120520361 CCGTATATCCTGAATTTGGGTGG - Intronic
1075353580 10:121748966-121748988 CAGACTATGCTGAAACTTGATGG + Intronic
1078087762 11:8244302-8244324 CAGTTTATGCTGTAACTAAGAGG - Intronic
1078377190 11:10806245-10806267 CAGTGAAAGCAGAAACTGGGTGG - Intronic
1079162914 11:18011593-18011615 CTGTATAATCTGAAACTGTGGGG - Intronic
1079559790 11:21807533-21807555 CAACATATGCTGAAACTCAGTGG - Intergenic
1080534296 11:33206707-33206729 CAGTGTATACTAAAATTGGGAGG + Intergenic
1080585114 11:33674747-33674769 CAGTAGATGTTGAAATTGGGTGG + Intergenic
1091196219 11:133732901-133732923 CAGGAGATGATGAGACTGGGAGG - Intergenic
1094278341 12:28705708-28705730 CAGCATATTGTGAAACTGGCCGG - Intergenic
1099626470 12:85081811-85081833 CACAATAGCCTGAAACTGGGAGG - Intronic
1102140460 12:110610844-110610866 TAGTGTATGCTGACATTGGGAGG - Intergenic
1102571181 12:113827857-113827879 CAGTAACTGCAGAAACTGAGAGG - Intronic
1103076327 12:117985835-117985857 GAGAATATCCTGAACCTGGGAGG - Intergenic
1103143641 12:118574674-118574696 CTGGATGTGCTGAAACGGGGGGG + Intergenic
1104167989 12:126252329-126252351 CAGATGATTCTGAAACTGGGGGG + Intergenic
1106435972 13:29722967-29722989 CAGCTGAAGCTGAAACTGGGTGG - Intergenic
1108506433 13:51116551-51116573 CAGTATATGGTGACCCTGGCTGG + Intergenic
1111850615 13:93568755-93568777 TAGTATATGATTAAACTGGATGG - Intronic
1113890738 13:113734455-113734477 CAGTGTCTGCTGGCACTGGGAGG + Intronic
1114743553 14:25122541-25122563 CAGCAGATGGTGAAACTGGTTGG - Intergenic
1115758489 14:36553898-36553920 CAGGCTATGCTGAATCTGTGAGG + Intergenic
1115982700 14:39071457-39071479 AAGAATCTGCTGAACCTGGGAGG + Intronic
1121473067 14:94171665-94171687 CAGTATCTTCTAAAACTGGAGGG - Intronic
1126013154 15:44322275-44322297 CAGAATATCTTGAACCTGGGAGG + Intronic
1126863909 15:52916443-52916465 AATTACATGCTGAAACTGGTAGG + Intergenic
1127223240 15:56902531-56902553 CAATAAATGTTGAAGCTGGGTGG + Intronic
1128068366 15:64777850-64777872 CAGAATAGCTTGAAACTGGGAGG - Intergenic
1130445763 15:84000100-84000122 AAGTATATGCAAAAACTGGTGGG - Intronic
1130749851 15:86699893-86699915 CAGTGGATGCTAAAACTGGTAGG - Intronic
1132809969 16:1792796-1792818 CAGAATATTCTGAAAATGGCCGG - Intronic
1136391248 16:29965824-29965846 GAGAATCTCCTGAAACTGGGAGG - Intronic
1136686704 16:31999156-31999178 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136787316 16:32942693-32942715 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1136882460 16:33911089-33911111 CAGCATGTGCAGAAACAGGGTGG - Intergenic
1141018358 16:80470968-80470990 CAGCAGATGCTGAAATTAGGGGG + Intergenic
1203089550 16_KI270728v1_random:1204365-1204387 CAGCATGTGCAGAAACAGGGTGG + Intergenic
1145256851 17:21330056-21330078 CAGTCATTGCTGAGACTGGGAGG - Intergenic
1145319760 17:21757896-21757918 CAGTCATTGCTGAGACTGGGAGG + Intergenic
1146643296 17:34557117-34557139 CAGTATTTGCAGAAGCTGGGAGG + Intergenic
1147846216 17:43405638-43405660 GAGTATATCTTGAACCTGGGAGG + Intergenic
1149599418 17:57883934-57883956 CAGGCTCTGCTGATACTGGGTGG + Intronic
1150104518 17:62452441-62452463 CAATAGATACTGAAACTAGGGGG - Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1152392678 17:80012060-80012082 CAGGATATCCTGAAACTGCGTGG - Intronic
1153817274 18:8801400-8801422 CAGTTTATCCTGCAACTGGGAGG + Intronic
1153846324 18:9052738-9052760 CAGAATATGGTGAAACATGGTGG + Intergenic
1156242813 18:35270002-35270024 CAGTATCTGCTAACACTGTGGGG + Intronic
1156297859 18:35809022-35809044 CAGCAGATGCTGAAACTGGTGGG + Intergenic
1158626788 18:59078510-59078532 CAGGACAGGCTGAAACTGGAGGG + Intergenic
1160738500 19:675537-675559 CAGTGTTTGCTGAATCTTGGAGG + Intergenic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1163176620 19:15568703-15568725 CAGTATCTCTTGAACCTGGGAGG + Intergenic
1164429704 19:28176529-28176551 CAGTCTAAGCTGAACCTGGTTGG + Intergenic
1166763968 19:45241657-45241679 CAGCAGATGCTGAAACCTGGAGG - Intronic
1167161733 19:47772243-47772265 CAGTAAATGCAAAAACTGTGAGG + Intergenic
1168450185 19:56460375-56460397 TAGTAGTTGCTGAACCTGGGGGG + Intronic
925378272 2:3404544-3404566 CATTATATGCATGAACTGGGAGG + Intronic
925511524 2:4631241-4631263 CAGTAGAGGCTGGAACTGGGAGG + Intergenic
928265792 2:29810600-29810622 CAGTCAACGTTGAAACTGGGAGG - Intronic
930789760 2:55313159-55313181 CAGAATAGCTTGAAACTGGGAGG - Intronic
932741756 2:74296181-74296203 CAGTATATGTTGAAAATTCGGGG + Intronic
935090004 2:99885937-99885959 CAGTATGTGATGAAACTAGTTGG - Intronic
937634120 2:124136749-124136771 AAGTTTATACTGAAACTGGATGG + Intronic
938810170 2:134845573-134845595 CAATAAATGCTAAAACTGGTTGG - Intronic
939478781 2:142721067-142721089 CAGAATATGGTGAAAATGGTGGG - Intergenic
942676868 2:178435585-178435607 CACTGTATGCTGATTCTGGGAGG - Intronic
943354681 2:186837195-186837217 CAGTATATGCAGGAAGAGGGAGG + Intronic
943465459 2:188223482-188223504 AAGCTTATGCTGAAACAGGGTGG - Intergenic
944092224 2:195924502-195924524 CAGAATAGCTTGAAACTGGGAGG + Intronic
944898172 2:204187355-204187377 GAGTAGATGCTGAAAAGGGGTGG + Intergenic
945784838 2:214220622-214220644 CTGAATATGCTAAAACTGGATGG + Intronic
946765162 2:223033687-223033709 CAGTGTATCCTGGAGCTGGGTGG - Intergenic
1169583814 20:7058112-7058134 GAGTTAATGCTGAAACTTGGGGG - Intergenic
1172911208 20:38410566-38410588 CAGTAAGTGATGAAACTGTGTGG + Intergenic
1182278132 22:29203070-29203092 CAATGTTTGCTGAAACTGAGAGG - Intergenic
1182306383 22:29371907-29371929 CTGTAAATGCTGAAATTGAGGGG - Intronic
950718083 3:14863818-14863840 CAGAAGATGTTGAATCTGGGTGG - Intronic
953373661 3:42410644-42410666 CAGGATATTCTGAAAAAGGGAGG + Intergenic
955587245 3:60493414-60493436 CAATATATGCTTACACTGTGAGG + Intronic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956980801 3:74634976-74634998 CTGGAGAGGCTGAAACTGGGAGG - Intergenic
960227235 3:115183090-115183112 CAGTATATGCCGAAAGTTGGGGG + Intergenic
962420462 3:135224644-135224666 CAATGGATGCTGAAATTGGGGGG - Intronic
964213685 3:154255752-154255774 CAGAACATGGTGAAACTAGGAGG - Exonic
964260385 3:154828736-154828758 CAGTGTATGCAGAACCTAGGGGG + Intergenic
965702364 3:171471106-171471128 CAGTATATGGGGAATCTGGTGGG - Intergenic
967895359 3:194391463-194391485 CAGTCTTGACTGAAACTGGGAGG + Intergenic
968241208 3:197087939-197087961 CTGTATACTCTGAAACTTGGTGG + Intronic
970296172 4:14633190-14633212 CAGTATAGTTTGAAATTGGGTGG - Intergenic
980697622 4:136380615-136380637 CACTACATACTGAAACTGGTAGG - Intergenic
988398996 5:30736712-30736734 ATGTATATGCTTAAACTGGGAGG - Intergenic
994998264 5:107093586-107093608 GAGTATAGGCTGAAACTATGTGG - Intergenic
995285998 5:110388794-110388816 CAGTACATGCAGAATCGGGGTGG + Intronic
998046934 5:138995335-138995357 CAGAATTTGTTGAACCTGGGAGG - Intronic
999191662 5:149752437-149752459 CAGTGTATGCTGAAACTAGTAGG - Intronic
999253703 5:150197345-150197367 CGGTACATGCTGAGACTGTGGGG - Intronic
999732776 5:154487699-154487721 CAGCATGGGCTGAAACTGAGTGG + Intergenic
1000102861 5:158033585-158033607 CAGTATTTCCCGCAACTGGGTGG + Intergenic
1000363124 5:160466595-160466617 CAGCATCTGCTGAAACCGGGTGG - Intergenic
1001689837 5:173624813-173624835 CAGTATATTCTGAAAAGGTGGGG + Intergenic
1003797886 6:9625922-9625944 CAGTATATTTTGAAATTAGGTGG + Intronic
1004465915 6:15884542-15884564 CAGAATAGCTTGAAACTGGGTGG + Intergenic
1006357821 6:33571153-33571175 CAGGATATTCTGAAACCAGGGGG - Intergenic
1006460598 6:34155391-34155413 CAGGAGATGCTGAGAGTGGGAGG - Intronic
1007834233 6:44662524-44662546 CTGTATTTCCTGTAACTGGGTGG + Intergenic
1009560583 6:65236516-65236538 CAGAATCTCCTGAACCTGGGAGG + Intronic
1009628033 6:66161858-66161880 CAATTTAAGCTGAACCTGGGTGG + Intergenic
1015654455 6:135500995-135501017 CAGTGTATGCTAAAACTAGAGGG + Intergenic
1015814136 6:137190911-137190933 CAAAATATGCTGATTCTGGGTGG + Intergenic
1017209091 6:151835069-151835091 CAGTTTAAGCTGAGAATGGGAGG + Intronic
1019420755 7:949670-949692 CAGTCTAGGCTGAAGTTGGGGGG + Intronic
1020402539 7:7795298-7795320 CAGCATATTCTGTAACTGAGTGG - Intronic
1023039901 7:36162977-36162999 CAGCTTATGCTAAAAGTGGGAGG + Intronic
1026828872 7:73599835-73599857 CAGAAGATTGTGAAACTGGGAGG + Intronic
1027640487 7:80727516-80727538 CAGTATCTGCTTACACTGGTTGG + Intergenic
1028004557 7:85547548-85547570 CAGAATGGGCTGAAACAGGGAGG - Intergenic
1028964749 7:96789737-96789759 CAGTTTATGCTGAATCTGTGTGG - Intergenic
1031877766 7:127161405-127161427 GAGTATAGGCTGGAAATGGGAGG - Intronic
1032033686 7:128505650-128505672 CAATAGATACTGAAACTAGGGGG - Intronic
1036196760 8:6724129-6724151 CAGTTTATTTTTAAACTGGGCGG - Intronic
1040587812 8:48760314-48760336 CAGTGTGTTCTGAAACTGAGAGG + Intergenic
1044129829 8:88508120-88508142 CAGCATATACTGAAACTGATAGG + Intergenic
1044675891 8:94728268-94728290 CAGTGTATACTGAGAGTGGGGGG - Intronic
1047541836 8:125775178-125775200 CAGAAAATGCTCAAACTGAGTGG - Intergenic
1048199741 8:132362440-132362462 CAGTTTCTGCTGGAACTGGAAGG - Intronic
1049627087 8:143629333-143629355 AAGTATAGGCTAAAACTGGAGGG - Intergenic
1050457387 9:5846996-5847018 GAGAATATGCTGAATCTGGTTGG - Intergenic
1050666216 9:7939359-7939381 CAGTAAATGCTGCAACTGGATGG - Intergenic
1052138701 9:24949456-24949478 CAGTACATGCAGAAAGTGGGAGG + Intergenic
1052453446 9:28663018-28663040 CATTATCTTCTGTAACTGGGAGG + Intronic
1053302124 9:36959768-36959790 CAGCCTGTGCTGCAACTGGGGGG + Intronic
1055871152 9:80881444-80881466 CAGCATATGCAGAAATTGTGCGG - Intergenic
1057398415 9:94700969-94700991 GAGAATATACTGAAACTGGGAGG + Intergenic
1061839732 9:133351550-133351572 CAGAATATCCTAAACCTGGGAGG - Intergenic
1185999466 X:4992400-4992422 CAACATAAGCTTAAACTGGGAGG - Intergenic
1186794437 X:13030647-13030669 CAGCACAGGCTGAAATTGGGTGG + Intergenic
1189376677 X:40472100-40472122 CAGTAAATGCTGCAGCTGGGTGG + Intergenic
1189774903 X:44461799-44461821 CAGCATATCTTAAAACTGGGAGG + Intergenic
1189913630 X:45836060-45836082 TAGTTTTTGCTGAAACTGGATGG + Intergenic
1190882121 X:54499010-54499032 CAGCATATGCAAAAACTTGGAGG - Intergenic
1192053012 X:67744564-67744586 CAGACTATGGTGAAACTGAGTGG - Intergenic
1195589165 X:106603842-106603864 AACTACATGCTGAAACTGGTGGG + Intergenic
1196007102 X:110848804-110848826 CAGTATATGCTGAAATTTCCAGG - Intergenic
1197641379 X:128971910-128971932 CAGTTTATGCTCAAGTTGGGTGG + Intergenic
1199880380 X:151969841-151969863 GATTAGATGCTGAAACTGTGTGG - Intronic
1202088980 Y:21169138-21169160 GAGAATAGGCTGAAACTGGGAGG + Intergenic